\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330722786:

Variant ID: vg0330722786 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30722786
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAGGGAGAGCGAAGAGGAAGAGAAAAAAGAGCCGGGAGGGACTTGTGGGGCCCACGTGGGCCCACCAATCTTTATTTTTTAGCTGACATGTGGGCCCA[C/T]
GTGGGCCCCACCATTCTTCATTTATGTGTGAGACTGACATGTGGGTCCCACAAAGTTTATTATTTTTCGGGATCAAATTGCCACGTATGCGCCACGTCAA

Reverse complement sequence

TTGACGTGGCGCATACGTGGCAATTTGATCCCGAAAAATAATAAACTTTGTGGGACCCACATGTCAGTCTCACACATAAATGAAGAATGGTGGGGCCCAC[G/A]
TGGGCCCACATGTCAGCTAAAAAATAAAGATTGGTGGGCCCACGTGGGCCCCACAAGTCCCTCCCGGCTCTTTTTTCTCTTCCTCTTCGCTCTCCCTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 8.30% 0.42% 0.51% NA
All Indica  2759 98.60% 0.20% 0.33% 0.87% NA
All Japonica  1512 74.30% 25.10% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.20% 0.67% 1.34% NA
Indica II  465 98.10% 0.20% 0.43% 1.29% NA
Indica III  913 99.20% 0.10% 0.11% 0.55% NA
Indica Intermediate  786 98.90% 0.30% 0.25% 0.64% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 25.00% 73.40% 1.59% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330722786 C -> T LOC_Os03g53580.1 upstream_gene_variant ; 533.0bp to feature; MODIFIER silent_mutation Average:90.793; most accessible tissue: Callus, score: 95.451 N N N N
vg0330722786 C -> T LOC_Os03g53560.1 downstream_gene_variant ; 4951.0bp to feature; MODIFIER silent_mutation Average:90.793; most accessible tissue: Callus, score: 95.451 N N N N
vg0330722786 C -> T LOC_Os03g53570.1 downstream_gene_variant ; 2883.0bp to feature; MODIFIER silent_mutation Average:90.793; most accessible tissue: Callus, score: 95.451 N N N N
vg0330722786 C -> T LOC_Os03g53590.1 downstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:90.793; most accessible tissue: Callus, score: 95.451 N N N N
vg0330722786 C -> T LOC_Os03g53590.2 downstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:90.793; most accessible tissue: Callus, score: 95.451 N N N N
vg0330722786 C -> T LOC_Os03g53570-LOC_Os03g53580 intergenic_region ; MODIFIER silent_mutation Average:90.793; most accessible tissue: Callus, score: 95.451 N N N N
vg0330722786 C -> DEL N N silent_mutation Average:90.793; most accessible tissue: Callus, score: 95.451 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330722786 C T -0.01 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330722786 NA 1.10E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.84E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 5.28E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 9.10E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.34E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 7.06E-08 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.62E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 2.96E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 2.07E-09 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 4.23E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 3.55E-07 1.56E-10 mr1742 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 4.81E-09 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.34E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.24E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.17E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 2.04E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.05E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.29E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.31E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.94E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 7.83E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.48E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 3.39E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.34E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 9.09E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330722786 NA 1.70E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251