\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330709449:

Variant ID: vg0330709449 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30709449
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTCCCGAATAAACCCTCATACTAATCTATTATTTCATTTATAGCCCTATTTCGGAACCAATGGTAGCGACCCGTACGCCATTGGATTAGATTTCAAC[A/G]
GTGTAGATTAACAGAGATTATTTTCACTAAGACCCCTATACTATTACATATTACATATCTAGACCCTTTCGTCGTCCTCGCCGTCCCCTTCCTCCCGTCT

Reverse complement sequence

AGACGGGAGGAAGGGGACGGCGAGGACGACGAAAGGGTCTAGATATGTAATATGTAATAGTATAGGGGTCTTAGTGAAAATAATCTCTGTTAATCTACAC[T/C]
GTTGAAATCTAATCCAATGGCGTACGGGTCGCTACCATTGGTTCCGAAATAGGGCTATAAATGAAATAATAGATTAGTATGAGGGTTTATTCGGGAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 10.80% 0.66% 0.00% NA
All Indica  2759 98.60% 1.20% 0.18% 0.00% NA
All Japonica  1512 67.70% 30.60% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 1.80% 0.34% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 0.80% 0.38% 0.00% NA
Temperate Japonica  767 43.00% 54.40% 2.61% 0.00% NA
Tropical Japonica  504 97.80% 1.80% 0.40% 0.00% NA
Japonica Intermediate  241 83.40% 14.90% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330709449 A -> G LOC_Os03g53530.1 upstream_gene_variant ; 4788.0bp to feature; MODIFIER silent_mutation Average:98.897; most accessible tissue: Zhenshan97 flag leaf, score: 99.859 N N N N
vg0330709449 A -> G LOC_Os03g53550.1 upstream_gene_variant ; 2066.0bp to feature; MODIFIER silent_mutation Average:98.897; most accessible tissue: Zhenshan97 flag leaf, score: 99.859 N N N N
vg0330709449 A -> G LOC_Os03g53560.1 upstream_gene_variant ; 4164.0bp to feature; MODIFIER silent_mutation Average:98.897; most accessible tissue: Zhenshan97 flag leaf, score: 99.859 N N N N
vg0330709449 A -> G LOC_Os03g53540.1 downstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:98.897; most accessible tissue: Zhenshan97 flag leaf, score: 99.859 N N N N
vg0330709449 A -> G LOC_Os03g53540-LOC_Os03g53550 intergenic_region ; MODIFIER silent_mutation Average:98.897; most accessible tissue: Zhenshan97 flag leaf, score: 99.859 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330709449 A G 0.08 0.12 0.06 0.09 0.05 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330709449 5.45E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 NA 1.34E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 4.96E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 8.02E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 NA 1.12E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 1.95E-07 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 NA 1.73E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 4.12E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 5.08E-12 1.26E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 6.49E-06 1.95E-11 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 NA 8.32E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 4.51E-10 1.71E-18 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330709449 8.13E-07 6.03E-11 mr1959_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251