\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330670598:

Variant ID: vg0330670598 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30670598
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAGTTTTTAAGTTTAATCGCTTTTGGACATACAAATGGAAATACATATGTGTGTTTGAATCGATTTTAATTTTGTTCGTTTTTGAAAATACATGAGTC[A/G]
TATAAGAAATCTATTTAAACAACTTGCATGCTAACTTGAGACGATTGGTCCCTAATTGCGGCTCCTATACCGTACAACAATAATAAGATTAAAATAGCCT

Reverse complement sequence

AGGCTATTTTAATCTTATTATTGTTGTACGGTATAGGAGCCGCAATTAGGGACCAATCGTCTCAAGTTAGCATGCAAGTTGTTTAAATAGATTTCTTATA[T/C]
GACTCATGTATTTTCAAAAACGAACAAAATTAAAATCGATTCAAACACACATATGTATTTCCATTTGTATGTCCAAAAGCGATTAAACTTAAAAACTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 10.20% 1.82% 0.00% NA
All Indica  2759 98.70% 0.90% 0.40% 0.00% NA
All Japonica  1512 66.20% 29.00% 4.76% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 96.60% 2.80% 0.65% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 0.50% 0.76% 0.00% NA
Temperate Japonica  767 41.30% 52.40% 6.26% 0.00% NA
Tropical Japonica  504 97.60% 1.20% 1.19% 0.00% NA
Japonica Intermediate  241 79.70% 12.90% 7.47% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330670598 A -> G LOC_Os03g53480.1 upstream_gene_variant ; 1748.0bp to feature; MODIFIER silent_mutation Average:21.749; most accessible tissue: Callus, score: 40.26 N N N N
vg0330670598 A -> G LOC_Os03g53470.1 downstream_gene_variant ; 4994.0bp to feature; MODIFIER silent_mutation Average:21.749; most accessible tissue: Callus, score: 40.26 N N N N
vg0330670598 A -> G LOC_Os03g53480-LOC_Os03g53490 intergenic_region ; MODIFIER silent_mutation Average:21.749; most accessible tissue: Callus, score: 40.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330670598 4.25E-07 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 NA 3.44E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 5.26E-08 NA mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 NA 2.65E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 3.31E-09 NA mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 NA 1.57E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 7.35E-09 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 NA 8.36E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 5.77E-08 4.25E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330670598 NA 4.99E-09 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251