\
| Variant ID: vg0330670598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 30670598 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCAGTTTTTAAGTTTAATCGCTTTTGGACATACAAATGGAAATACATATGTGTGTTTGAATCGATTTTAATTTTGTTCGTTTTTGAAAATACATGAGTC[A/G]
TATAAGAAATCTATTTAAACAACTTGCATGCTAACTTGAGACGATTGGTCCCTAATTGCGGCTCCTATACCGTACAACAATAATAAGATTAAAATAGCCT
AGGCTATTTTAATCTTATTATTGTTGTACGGTATAGGAGCCGCAATTAGGGACCAATCGTCTCAAGTTAGCATGCAAGTTGTTTAAATAGATTTCTTATA[T/C]
GACTCATGTATTTTCAAAAACGAACAAAATTAAAATCGATTCAAACACACATATGTATTTCCATTTGTATGTCCAAAAGCGATTAAACTTAAAAACTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 10.20% | 1.82% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 0.90% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 66.20% | 29.00% | 4.76% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.60% | 2.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 0.50% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 41.30% | 52.40% | 6.26% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 1.20% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 12.90% | 7.47% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0330670598 | A -> G | LOC_Os03g53480.1 | upstream_gene_variant ; 1748.0bp to feature; MODIFIER | silent_mutation | Average:21.749; most accessible tissue: Callus, score: 40.26 | N | N | N | N |
| vg0330670598 | A -> G | LOC_Os03g53470.1 | downstream_gene_variant ; 4994.0bp to feature; MODIFIER | silent_mutation | Average:21.749; most accessible tissue: Callus, score: 40.26 | N | N | N | N |
| vg0330670598 | A -> G | LOC_Os03g53480-LOC_Os03g53490 | intergenic_region ; MODIFIER | silent_mutation | Average:21.749; most accessible tissue: Callus, score: 40.26 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0330670598 | 4.25E-07 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | NA | 3.44E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | 5.26E-08 | NA | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | NA | 2.65E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | 3.31E-09 | NA | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | NA | 1.57E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | 7.35E-09 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | NA | 8.36E-09 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | 5.77E-08 | 4.25E-15 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330670598 | NA | 4.99E-09 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |