Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330666534:

Variant ID: vg0330666534 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30666534
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCAACATGGGCGGAGCTACCATGATTCTCGGGTATTCCCGGGAATACCCAACTTTTTTATCGAAAAACAAGTATATTTCTAATATATACATATGTACA[C/T]
ATATTAGTGCACCTAAATCCTCAATTATTCGATCCAAACATAGCCCTATACACATGTACATATATTAGTGCACCTAAATCCTCAATTCTTCGATCCAAAC

Reverse complement sequence

GTTTGGATCGAAGAATTGAGGATTTAGGTGCACTAATATATGTACATGTGTATAGGGCTATGTTTGGATCGAATAATTGAGGATTTAGGTGCACTAATAT[G/A]
TGTACATATGTATATATTAGAAATATACTTGTTTTTCGATAAAAAAGTTGGGTATTCCCGGGAATACCCGAGAATCATGGTAGCTCCGCCCATGTTGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 1.70% 0.36% 18.26% NA
All Indica  2759 78.80% 0.00% 0.11% 21.06% NA
All Japonica  1512 93.80% 5.30% 0.73% 0.13% NA
Aus  269 4.10% 0.00% 0.74% 95.17% NA
Indica I  595 97.10% 0.00% 0.00% 2.86% NA
Indica II  465 93.80% 0.00% 0.00% 6.24% NA
Indica III  913 57.20% 0.00% 0.33% 42.50% NA
Indica Intermediate  786 81.30% 0.00% 0.00% 18.70% NA
Temperate Japonica  767 99.00% 0.70% 0.39% 0.00% NA
Tropical Japonica  504 94.60% 5.00% 0.20% 0.20% NA
Japonica Intermediate  241 75.90% 20.70% 2.90% 0.41% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 81.10% 1.10% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330666534 C -> T LOC_Os03g53450.1 downstream_gene_variant ; 3473.0bp to feature; MODIFIER silent_mutation Average:77.467; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg0330666534 C -> T LOC_Os03g53470.1 downstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:77.467; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg0330666534 C -> T LOC_Os03g53480.1 downstream_gene_variant ; 134.0bp to feature; MODIFIER silent_mutation Average:77.467; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg0330666534 C -> T LOC_Os03g53470-LOC_Os03g53480 intergenic_region ; MODIFIER silent_mutation Average:77.467; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg0330666534 C -> DEL N N silent_mutation Average:77.467; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330666534 C T -0.01 -0.02 -0.03 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330666534 2.71E-06 2.71E-06 mr1067_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330666534 NA 3.59E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251