\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330512638:

Variant ID: vg0330512638 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30512638
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTATATCTACTTCTTATTAAACTGTTATTTGGGTTTATATTCACGCCATCATGCTATGTGATCAAAGGGTAGCGGTCGGCGTGTGTCTTATGTGAC[G/A]
AATAGAAAAATCAAGATTTTAAAAGTTATTAAAGAGAAATAGAATTGTACCGTAGCGTTTAGCACGGGCATATTACTAGTTAGATACGATTAATTAAGTT

Reverse complement sequence

AACTTAATTAATCGTATCTAACTAGTAATATGCCCGTGCTAAACGCTACGGTACAATTCTATTTCTCTTTAATAACTTTTAAAATCTTGATTTTTCTATT[C/T]
GTCACATAAGACACACGCCGACCGCTACCCTTTGATCACATAGCATGATGGCGTGAATATAAACCCAAATAACAGTTTAATAAGAAGTAGATATAAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.40% 1.10% 0.34% 2.16% NA
All Indica  2759 93.90% 1.80% 0.58% 3.70% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.20% 3.90% 2.02% 4.87% NA
Indica II  465 99.40% 0.20% 0.00% 0.43% NA
Indica III  913 98.70% 0.00% 0.00% 1.31% NA
Indica Intermediate  786 88.50% 3.40% 0.51% 7.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330512638 G -> A LOC_Os03g53180.1 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0330512638 G -> A LOC_Os03g53190.1 upstream_gene_variant ; 1218.0bp to feature; MODIFIER silent_mutation Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0330512638 G -> A LOC_Os03g53200.1 upstream_gene_variant ; 4898.0bp to feature; MODIFIER silent_mutation Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0330512638 G -> A LOC_Os03g53190.2 upstream_gene_variant ; 1336.0bp to feature; MODIFIER silent_mutation Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0330512638 G -> A LOC_Os03g53180-LOC_Os03g53190 intergenic_region ; MODIFIER silent_mutation Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0330512638 G -> DEL N N silent_mutation Average:58.479; most accessible tissue: Minghui63 flower, score: 75.455 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330512638 NA 8.74E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638 NA 6.65E-06 mr1171 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638 1.68E-06 1.68E-06 mr1329 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638 NA 3.89E-09 mr1457 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638 NA 2.83E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638 NA 1.55E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638 2.61E-09 2.61E-09 mr1524 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512638 NA 4.58E-06 mr1673 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251