\
| Variant ID: vg0330512598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 30512598 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 254. )
GACAACCACTTGTTATCTTGTTATACATGGTAAAACTATTAATTTTATATCTACTTCTTATTAAACTGTTATTTGGGTTTATATTCACGCCATCATGCTA[T/G]
GTGATCAAAGGGTAGCGGTCGGCGTGTGTCTTATGTGACGAATAGAAAAATCAAGATTTTAAAAGTTATTAAAGAGAAATAGAATTGTACCGTAGCGTTT
AAACGCTACGGTACAATTCTATTTCTCTTTAATAACTTTTAAAATCTTGATTTTTCTATTCGTCACATAAGACACACGCCGACCGCTACCCTTTGATCAC[A/C]
TAGCATGATGGCGTGAATATAAACCCAAATAACAGTTTAATAAGAAGTAGATATAAAATTAATAGTTTTACCATGTATAACAAGATAACAAGTGGTTGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 1.50% | 0.63% | 5.78% | NA |
| All Indica | 2759 | 86.40% | 2.60% | 1.09% | 9.89% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.90% | 4.50% | 2.35% | 7.23% | NA |
| Indica II | 465 | 95.10% | 0.60% | 0.00% | 4.30% | NA |
| Indica III | 913 | 90.70% | 0.10% | 0.11% | 9.09% | NA |
| Indica Intermediate | 786 | 76.80% | 5.10% | 1.91% | 16.16% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0330512598 | T -> DEL | N | N | silent_mutation | Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
| vg0330512598 | T -> G | LOC_Os03g53180.1 | upstream_gene_variant ; 4607.0bp to feature; MODIFIER | silent_mutation | Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
| vg0330512598 | T -> G | LOC_Os03g53190.1 | upstream_gene_variant ; 1258.0bp to feature; MODIFIER | silent_mutation | Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
| vg0330512598 | T -> G | LOC_Os03g53200.1 | upstream_gene_variant ; 4938.0bp to feature; MODIFIER | silent_mutation | Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
| vg0330512598 | T -> G | LOC_Os03g53190.2 | upstream_gene_variant ; 1376.0bp to feature; MODIFIER | silent_mutation | Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
| vg0330512598 | T -> G | LOC_Os03g53180-LOC_Os03g53190 | intergenic_region ; MODIFIER | silent_mutation | Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0330512598 | NA | 8.47E-06 | mr1171 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330512598 | 7.09E-06 | 7.09E-06 | mr1329 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330512598 | 3.80E-06 | NA | mr1457 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330512598 | NA | 1.04E-08 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330512598 | NA | 3.64E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330512598 | 1.56E-06 | 1.56E-06 | mr1524 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330512598 | NA | 2.22E-08 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |