\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330512598:

Variant ID: vg0330512598 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30512598
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GACAACCACTTGTTATCTTGTTATACATGGTAAAACTATTAATTTTATATCTACTTCTTATTAAACTGTTATTTGGGTTTATATTCACGCCATCATGCTA[T/G]
GTGATCAAAGGGTAGCGGTCGGCGTGTGTCTTATGTGACGAATAGAAAAATCAAGATTTTAAAAGTTATTAAAGAGAAATAGAATTGTACCGTAGCGTTT

Reverse complement sequence

AAACGCTACGGTACAATTCTATTTCTCTTTAATAACTTTTAAAATCTTGATTTTTCTATTCGTCACATAAGACACACGCCGACCGCTACCCTTTGATCAC[A/C]
TAGCATGATGGCGTGAATATAAACCCAAATAACAGTTTAATAAGAAGTAGATATAAAATTAATAGTTTTACCATGTATAACAAGATAACAAGTGGTTGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 1.50% 0.63% 5.78% NA
All Indica  2759 86.40% 2.60% 1.09% 9.89% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.90% 4.50% 2.35% 7.23% NA
Indica II  465 95.10% 0.60% 0.00% 4.30% NA
Indica III  913 90.70% 0.10% 0.11% 9.09% NA
Indica Intermediate  786 76.80% 5.10% 1.91% 16.16% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330512598 T -> DEL N N silent_mutation Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0330512598 T -> G LOC_Os03g53180.1 upstream_gene_variant ; 4607.0bp to feature; MODIFIER silent_mutation Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0330512598 T -> G LOC_Os03g53190.1 upstream_gene_variant ; 1258.0bp to feature; MODIFIER silent_mutation Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0330512598 T -> G LOC_Os03g53200.1 upstream_gene_variant ; 4938.0bp to feature; MODIFIER silent_mutation Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0330512598 T -> G LOC_Os03g53190.2 upstream_gene_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0330512598 T -> G LOC_Os03g53180-LOC_Os03g53190 intergenic_region ; MODIFIER silent_mutation Average:58.549; most accessible tissue: Minghui63 flower, score: 73.972 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330512598 NA 8.47E-06 mr1171 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598 7.09E-06 7.09E-06 mr1329 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598 3.80E-06 NA mr1457 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598 NA 1.04E-08 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598 NA 3.64E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598 1.56E-06 1.56E-06 mr1524 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330512598 NA 2.22E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251