\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330484032:

Variant ID: vg0330484032 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30484032
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATTAACGAAGTATGTTGCATCCTAAACTATTCATAATACTTTCATACATTATGATCTAATCATTCAGATTTTATTGATAGTCTAAGTTAAAGTCGTG[T/A]
TAATCAATGGTGGTATTTATTTATGGAAACCAAAGGGAGTTTTTTTTTATTTTTATTTCATGTTCATGCTACATATAACAATTGTTAAAGTAATATTGGA

Reverse complement sequence

TCCAATATTACTTTAACAATTGTTATATGTAGCATGAACATGAAATAAAAATAAAAAAAAACTCCCTTTGGTTTCCATAAATAAATACCACCATTGATTA[A/T]
CACGACTTTAACTTAGACTATCAATAAAATCTGAATGATTAGATCATAATGTATGAAAGTATTATGAATAGTTTAGGATGCAACATACTTCGTTAATATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.30% 0.11% 0.00% NA
All Indica  2759 91.40% 8.40% 0.14% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.17% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 84.50% 15.10% 0.38% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330484032 T -> A LOC_Os03g53150.1 upstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:38.328; most accessible tissue: Callus, score: 76.214 N N N N
vg0330484032 T -> A LOC_Os03g53160.1 upstream_gene_variant ; 3375.0bp to feature; MODIFIER silent_mutation Average:38.328; most accessible tissue: Callus, score: 76.214 N N N N
vg0330484032 T -> A LOC_Os03g53150.2 upstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:38.328; most accessible tissue: Callus, score: 76.214 N N N N
vg0330484032 T -> A LOC_Os03g53140.1 downstream_gene_variant ; 1899.0bp to feature; MODIFIER silent_mutation Average:38.328; most accessible tissue: Callus, score: 76.214 N N N N
vg0330484032 T -> A LOC_Os03g53140.2 downstream_gene_variant ; 3865.0bp to feature; MODIFIER silent_mutation Average:38.328; most accessible tissue: Callus, score: 76.214 N N N N
vg0330484032 T -> A LOC_Os03g53140.3 downstream_gene_variant ; 1908.0bp to feature; MODIFIER silent_mutation Average:38.328; most accessible tissue: Callus, score: 76.214 N N N N
vg0330484032 T -> A LOC_Os03g53150-LOC_Os03g53160 intergenic_region ; MODIFIER silent_mutation Average:38.328; most accessible tissue: Callus, score: 76.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330484032 NA 6.40E-35 mr1723 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330484032 NA 4.34E-36 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251