\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330295614:

Variant ID: vg0330295614 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30295614
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGTTTCTGAGCAAGTTGACCATCTTCTCAAGCAAGCGACAAGCATTGACAATTTGTGCAATATGTATGAGGGGTGGACACCTTGGATATGATTCAAAG[A/G]
TACATGTGAACATGTCTTTCTACGATTTGTTTTTTCCAGGTATCAACTGAAAATATAAGATCCCCCTATAGGTTTGTTTAGTACCTTGTGATAGAAGGGG

Reverse complement sequence

CCCCTTCTATCACAAGGTACTAAACAAACCTATAGGGGGATCTTATATTTTCAGTTGATACCTGGAAAAAACAAATCGTAGAAAGACATGTTCACATGTA[T/C]
CTTTGAATCATATCCAAGGTGTCCACCCCTCATACATATTGCACAAATTGTCAATGCTTGTCGCTTGCTTGAGAAGATGGTCAACTTGCTCAGAAACCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.70% 0.15% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 94.60% 5.00% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 84.50% 14.30% 1.19% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330295614 A -> G LOC_Os03g52820.1 upstream_gene_variant ; 3704.0bp to feature; MODIFIER silent_mutation Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0330295614 A -> G LOC_Os03g52840.1 upstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0330295614 A -> G LOC_Os03g52840.2 upstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0330295614 A -> G LOC_Os03g52840.3 upstream_gene_variant ; 4324.0bp to feature; MODIFIER silent_mutation Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0330295614 A -> G LOC_Os03g52830.1 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg0330295614 A -> G LOC_Os03g52830-LOC_Os03g52840 intergenic_region ; MODIFIER silent_mutation Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330295614 NA 2.94E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 4.56E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 5.79E-07 5.79E-07 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 3.20E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 1.46E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 5.95E-08 5.95E-08 mr1562_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 4.12E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 8.37E-06 8.37E-06 mr1605_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 5.48E-07 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 6.91E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 6.40E-07 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 3.92E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330295614 NA 6.90E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251