\
| Variant ID: vg0330295614 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 30295614 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 336. )
AAGGTTTCTGAGCAAGTTGACCATCTTCTCAAGCAAGCGACAAGCATTGACAATTTGTGCAATATGTATGAGGGGTGGACACCTTGGATATGATTCAAAG[A/G]
TACATGTGAACATGTCTTTCTACGATTTGTTTTTTCCAGGTATCAACTGAAAATATAAGATCCCCCTATAGGTTTGTTTAGTACCTTGTGATAGAAGGGG
CCCCTTCTATCACAAGGTACTAAACAAACCTATAGGGGGATCTTATATTTTCAGTTGATACCTGGAAAAAACAAATCGTAGAAAGACATGTTCACATGTA[T/C]
CTTTGAATCATATCCAAGGTGTCCACCCCTCATACATATTGCACAAATTGTCAATGCTTGTCGCTTGCTTGAGAAGATGGTCAACTTGCTCAGAAACCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 94.60% | 5.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.50% | 14.30% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0330295614 | A -> G | LOC_Os03g52820.1 | upstream_gene_variant ; 3704.0bp to feature; MODIFIER | silent_mutation | Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| vg0330295614 | A -> G | LOC_Os03g52840.1 | upstream_gene_variant ; 3937.0bp to feature; MODIFIER | silent_mutation | Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| vg0330295614 | A -> G | LOC_Os03g52840.2 | upstream_gene_variant ; 3937.0bp to feature; MODIFIER | silent_mutation | Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| vg0330295614 | A -> G | LOC_Os03g52840.3 | upstream_gene_variant ; 4324.0bp to feature; MODIFIER | silent_mutation | Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| vg0330295614 | A -> G | LOC_Os03g52830.1 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| vg0330295614 | A -> G | LOC_Os03g52830-LOC_Os03g52840 | intergenic_region ; MODIFIER | silent_mutation | Average:57.923; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0330295614 | NA | 2.94E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 4.56E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | 5.79E-07 | 5.79E-07 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 3.20E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 1.46E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | 5.95E-08 | 5.95E-08 | mr1562_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 4.12E-06 | mr1575_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | 8.37E-06 | 8.37E-06 | mr1605_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 5.48E-07 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 6.91E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 6.40E-07 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 3.92E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330295614 | NA | 6.90E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |