Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0330235697:

Variant ID: vg0330235697 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30235697
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.19, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCGATTTTTAAAAATCGCCCTCCCAGAGGGCGGTAGGCGACTACTTCCGTCAATTTTCAAAATAGAAAATTATTTTTGTAAAACTTTTAATAAAAAAA[A/G]
TTAAAAATAAAAAAAATTCCCAAAAGATCAACAGGGGAGGGGGGAACGCTACTGGGCCGGGCCGACTCGTCTCCCCCACGGGTTTCTTACTGGGCCGAGC

Reverse complement sequence

GCTCGGCCCAGTAAGAAACCCGTGGGGGAGACGAGTCGGCCCGGCCCAGTAGCGTTCCCCCCTCCCCTGTTGATCTTTTGGGAATTTTTTTTATTTTTAA[T/C]
TTTTTTTATTAAAAGTTTTACAAAAATAATTTTCTATTTTGAAAATTGACGGAAGTAGTCGCCTACCGCCCTCTGGGAGGGCGATTTTTAAAAATCGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 34.90% 0.08% 0.00% NA
All Indica  2759 98.80% 1.10% 0.11% 0.00% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.70% 0.25% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330235697 A -> G LOC_Os03g52740.1 upstream_gene_variant ; 1034.0bp to feature; MODIFIER silent_mutation Average:98.463; most accessible tissue: Callus, score: 98.882 N N N N
vg0330235697 A -> G LOC_Os03g52750.1 upstream_gene_variant ; 186.0bp to feature; MODIFIER silent_mutation Average:98.463; most accessible tissue: Callus, score: 98.882 N N N N
vg0330235697 A -> G LOC_Os03g52750.2 upstream_gene_variant ; 186.0bp to feature; MODIFIER silent_mutation Average:98.463; most accessible tissue: Callus, score: 98.882 N N N N
vg0330235697 A -> G LOC_Os03g52740-LOC_Os03g52750 intergenic_region ; MODIFIER silent_mutation Average:98.463; most accessible tissue: Callus, score: 98.882 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330235697 A G 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330235697 NA 7.31E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 4.76E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 2.94E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 7.76E-29 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 3.12E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 9.82E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 4.38E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 1.34E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 5.59E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 1.30E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 6.09E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 1.94E-06 3.82E-07 mr1607_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 1.11E-32 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 3.08E-06 3.08E-06 mr1848_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 NA 1.99E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330235697 9.40E-06 4.52E-07 mr1888_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251