Search for Variation information by Variation ID:
Detailed information for vg0330231538:
| Variant ID: vg0330231538 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 30231538 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )
Flanking Sequence (100 bp) in Reference Genome:
CGCGCGGGCGTGATTCACTTTATGTCAGCAGGCAGCGCCGAAAGTTGATAGTGACTACTCGAGCTGCCGCTTTTCATGTGTGCTGTTGCGGACTGTGCGC[G/A]
CTACTGGATCTGACACTACCGTGAAGCGCCGAAAGTGTGTTGTCGTGAGCATAAGTTGTTCTAGCACCATATGAATGAAAAGAACTATGTAGACGAGATA
Reverse complement sequence
TATCTCGTCTACATAGTTCTTTTCATTCATATGGTGCTAGAACAACTTATGCTCACGACAACACACTTTCGGCGCTTCACGGTAGTGTCAGATCCAGTAG[C/T]
GCGCACAGTCCGCAACAGCACACATGAAAAGCGGCAGCTCGAGTAGTCACTATCAACTTTCGGCGCTGCCTGCTGACATAAAGTGAATCACGCCCGCGCG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 42.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 28.40% | 71.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 32.70% | 67.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0330231538 | G -> A | LOC_Os03g52740.1 | missense_variant ; p.Ala609Val; MODERATE | nonsynonymous_codon ; A609V | Average:8.876; most accessible tissue: Callus, score: 13.543 | benign  |
1.126 |
DELETERIOUS | 0.01 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0330231538 | NA | 8.42E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330231538 | NA | 1.07E-13 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330231538 | NA | 4.60E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330231538 | NA | 1.26E-15 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330231538 | 7.78E-06 | 7.78E-06 | mr1529_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330231538 | NA | 1.49E-07 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330231538 | NA | 8.16E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |