Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329857775:

Variant ID: vg0329857775 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 29857775
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTCCAACGAGACGACAGTATGTCGCCACGTTAGTTTTTCATTATAGGTTTCTATAACAGGAGATAGAGGGTCCGGCTAATACGCGATTAGTCGTTGAC[G/A]
GACGCGGCACACGATCGGCGACACTCGACACGTTTTTCCCTGAGCCTAGCTCGCGGCTTGCCTACACACGTGCATGTTCGATGAGTCTAAAACCAATTTA

Reverse complement sequence

TAAATTGGTTTTAGACTCATCGAACATGCACGTGTGTAGGCAAGCCGCGAGCTAGGCTCAGGGAAAAACGTGTCGAGTGTCGCCGATCGTGTGCCGCGTC[C/T]
GTCAACGACTAATCGCGTATTAGCCGGACCCTCTATCTCCTGTTATAGAAACCTATAATGAAAAACTAACGTGGCGACATACTGTCGTCTCGTTGGAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 8.60% 0.72% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 73.60% 24.20% 2.18% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 98.20% 0.50% 1.30% 0.00% NA
Tropical Japonica  504 28.80% 68.30% 2.98% 0.00% NA
Japonica Intermediate  241 89.20% 7.50% 3.32% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0329857775 G -> A LOC_Os03g52030.1 upstream_gene_variant ; 2497.0bp to feature; MODIFIER silent_mutation Average:91.909; most accessible tissue: Minghui63 root, score: 98.242 N N N N
vg0329857775 G -> A LOC_Os03g52040.2 upstream_gene_variant ; 1130.0bp to feature; MODIFIER silent_mutation Average:91.909; most accessible tissue: Minghui63 root, score: 98.242 N N N N
vg0329857775 G -> A LOC_Os03g52040.1 upstream_gene_variant ; 1130.0bp to feature; MODIFIER silent_mutation Average:91.909; most accessible tissue: Minghui63 root, score: 98.242 N N N N
vg0329857775 G -> A LOC_Os03g52040.3 upstream_gene_variant ; 1130.0bp to feature; MODIFIER silent_mutation Average:91.909; most accessible tissue: Minghui63 root, score: 98.242 N N N N
vg0329857775 G -> A LOC_Os03g52020.1 downstream_gene_variant ; 4664.0bp to feature; MODIFIER silent_mutation Average:91.909; most accessible tissue: Minghui63 root, score: 98.242 N N N N
vg0329857775 G -> A LOC_Os03g52030-LOC_Os03g52040 intergenic_region ; MODIFIER silent_mutation Average:91.909; most accessible tissue: Minghui63 root, score: 98.242 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0329857775 G A -0.13 -0.02 -0.01 -0.05 -0.08 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0329857775 2.72E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 2.85E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 2.44E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 3.96E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 4.12E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 4.81E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 9.77E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 1.85E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 3.28E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 5.88E-06 mr1345_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 9.82E-07 3.18E-12 mr1388_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 5.53E-07 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 2.62E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 3.65E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 3.02E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 9.60E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 1.43E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 6.73E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 7.99E-10 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 1.10E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 1.16E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 9.89E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 2.34E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 3.12E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 7.15E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329857775 NA 2.13E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251