Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329650051:

Variant ID: vg0329650051 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 29650051
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.24, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGCATGAGAAATTTGACAAAACATTGACATCTGCAGGCTTTGCAGTCAATAAGGCAGATAAATGTGTGTACTATCGCCATGGTGGGGGTGAGGGAGTT[C/A]
TTCTGTGCTTGTATGTTGATGACATACTGATATTTGGGACAAACCTTGAGGTGATAAATGAGGTTAAATCATTCTTGTCTCAAAATTTTGATATGAAGGA

Reverse complement sequence

TCCTTCATATCAAAATTTTGAGACAAGAATGATTTAACCTCATTTATCACCTCAAGGTTTGTCCCAAATATCAGTATGTCATCAACATACAAGCACAGAA[G/T]
AACTCCCTCACCCCCACCATGGCGATAGTACACACATTTATCTGCCTTATTGACTGCAAAGCCTGCAGATGTCAATGTTTTGTCAAATTTCTCATGCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	0.20%	28.93%	13.25%	NA
All Indica	2759	39.30%	0.20%	41.94%	18.52%	NA
All Japonica	1512	99.30%	0.00%	0.40%	0.26%	NA
Aus	269	0.00%	0.70%	60.97%	38.29%	NA
Indica I	595	67.10%	0.30%	8.07%	24.54%	NA
Indica II	465	8.40%	0.20%	60.43%	30.97%	NA
Indica III	913	35.60%	0.00%	54.76%	9.64%	NA
Indica Intermediate	786	41.00%	0.40%	41.73%	16.92%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.00%	0.00%	0.60%	0.40%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	89.60%	0.00%	8.33%	2.08%	NA
Intermediate	90	57.80%	0.00%	35.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0329650051	C -> A	LOC_Os03g51730.1	missense_variant ; p.Leu225Ile; MODERATE	nonsynonymous_codon ; L225I	Average:19.995; most accessible tissue: Zhenshan97 panicle, score: 39.652	benign	-0.453	TOLERATED	1.00
vg0329650051	C -> DEL	LOC_Os03g51730.1	N	frameshift_variant	Average:19.995; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0329650051	NA	7.98E-07	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	2.63E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	2.27E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	1.13E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	2.10E-06	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	2.51E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	6.59E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	6.74E-07	2.44E-09	mr1850	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	9.72E-06	9.72E-06	mr1850	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	1.72E-18	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	3.22E-08	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	8.08E-06	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329650051	NA	3.09E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251