Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329592660:

Variant ID: vg0329592660 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 29592660
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGTCGTCCTGGGTTTACAAAACTTTGGGTCATTTGGTGTGTTTAGTTTACGTTAAAATTGCTAGTTTGGTTGAAATTGTAACGATGTGATGGAAAAA[T/C,A]
TAAAAGTTTGTGTGTAGGAAAGTTTTGATGTGATGAAAAAGTTGAAAGTTTGAAGAAAAAGTTTGGAACTAAACAAGGGCTTAATCAAAACGGGGTGTTT

Reverse complement sequence

AAACACCCCGTTTTGATTAAGCCCTTGTTTAGTTCCAAACTTTTTCTTCAAACTTTCAACTTTTTCATCACATCAAAACTTTCCTACACACAAACTTTTA[A/G,T]
TTTTTCCATCACATCGTTACAATTTCAACCAAACTAGCAATTTTAACGTAAACTAAACACACCAAATGACCCAAAGTTTTGTAAACCCAGGACGACAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.60% 0.02% 0.00% A: 0.04%
All Indica  2759 92.90% 7.10% 0.00% 0.00% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 95.50% 4.50% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.50% 0.00% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 53.30% 43.30% 1.11% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0329592660 T -> C LOC_Os03g51670.1 upstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> C LOC_Os03g51670.2 upstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> C LOC_Os03g51680.1 downstream_gene_variant ; 306.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> C LOC_Os03g51690.1 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> C LOC_Os03g51680.2 downstream_gene_variant ; 306.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> C LOC_Os03g51690.3 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> C LOC_Os03g51690.2 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> C LOC_Os03g51670-LOC_Os03g51680 intergenic_region ; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51670.1 upstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51670.2 upstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51680.1 downstream_gene_variant ; 306.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51690.1 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51680.2 downstream_gene_variant ; 306.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51690.3 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51690.2 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0329592660 T -> A LOC_Os03g51670-LOC_Os03g51680 intergenic_region ; MODIFIER silent_mutation Average:60.787; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0329592660 NA 3.65E-31 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329592660 NA 1.69E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329592660 NA 3.88E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329592660 NA 3.16E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329592660 NA 1.49E-39 mr1723_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329592660 NA 9.32E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251