Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329591528:

Variant ID: vg0329591528 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 29591528
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATTTAATTAAATAAAAGTTGCAAAAGATCTAGATGTAATAGTAGCGTGACATATATAATACTATGTGAAACTCCGCGTATTGCTGCGGGAACTTAGTA[T/C]
GATAACAATAAAAAAAAGAACGTGTAAGATAGCTATATAATATCAGATTAAGTAAATTAATGTGGTTTATGATAATTTAAATTTAAATAGTATGTAGAAT

Reverse complement sequence

ATTCTACATACTATTTAAATTTAAATTATCATAAACCACATTAATTTACTTAATCTGATATTATATAGCTATCTTACACGTTCTTTTTTTTATTGTTATC[A/G]
TACTAAGTTCCCGCAGCAATACGCGGAGTTTCACATAGTATTATATATGTCACGCTACTATTACATCTAGATCTTTTGCAACTTTTATTTAATTAAATTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	19.20%	0.44%	10.01%	NA
All Indica	2759	61.90%	32.10%	0.36%	5.62%	NA
All Japonica	1512	99.50%	0.40%	0.00%	0.13%	NA
Aus	269	1.90%	0.40%	1.12%	96.65%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	43.70%	48.80%	0.22%	7.31%	NA
Indica III	913	43.40%	49.40%	0.44%	6.79%	NA
Indica Intermediate	786	66.20%	25.70%	0.64%	7.51%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.00%	0.83%	NA
VI/Aromatic	96	47.90%	1.00%	7.29%	43.75%	NA
Intermediate	90	68.90%	14.40%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0329591528	T -> C	LOC_Os03g51670.1	upstream_gene_variant ; 221.0bp to feature; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> C	LOC_Os03g51670.2	upstream_gene_variant ; 221.0bp to feature; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> C	LOC_Os03g51680.1	downstream_gene_variant ; 1438.0bp to feature; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> C	LOC_Os03g51690.1	downstream_gene_variant ; 4749.0bp to feature; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> C	LOC_Os03g51680.2	downstream_gene_variant ; 1438.0bp to feature; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> C	LOC_Os03g51690.3	downstream_gene_variant ; 4749.0bp to feature; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> C	LOC_Os03g51690.2	downstream_gene_variant ; 4749.0bp to feature; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> C	LOC_Os03g51670-LOC_Os03g51680	intergenic_region ; MODIFIER	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg0329591528	T -> DEL	N	N	silent_mutation	Average:43.095; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0329591528	NA	8.79E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	4.09E-06	4.09E-06	mr1507	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	9.51E-07	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	3.44E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	5.67E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	4.40E-06	4.40E-06	mr1809	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	3.00E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	2.84E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	4.48E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	4.18E-08	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	1.05E-07	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	1.11E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329591528	NA	2.70E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251