\
| Variant ID: vg0329183619 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 29183619 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 115. )
ATTACACTGTAACTATAGTGTAACTTGTATGTCACTTTCAAAAATCTCTACGTAATATGTTATTTCGGTAAAACAGAAGTTGTGGGAACAAATCCTTACA[C/T]
ATATATGTGTGCTGTGATTTTATTTTTCTTCCTCACCAAAACAAATCTTGTAATAGATCTAAAGGTTTAAAATTACATGAAACTTATATACAAGTTACAC
GTGTAACTTGTATATAAGTTTCATGTAATTTTAAACCTTTAGATCTATTACAAGATTTGTTTTGGTGAGGAAGAAAAATAAAATCACAGCACACATATAT[G/A]
TGTAAGGATTTGTTCCCACAACTTCTGTTTTACCGAAATAACATATTACGTAGAGATTTTTGAAAGTGACATACAAGTTACACTATAGTTACAGTGTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 27.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 60.20% | 39.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 36.80% | 63.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 43.70% | 56.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 68.10% | 31.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0329183619 | C -> T | LOC_Os03g51040.1 | upstream_gene_variant ; 478.0bp to feature; MODIFIER | silent_mutation | Average:41.149; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0329183619 | C -> T | LOC_Os03g51050.1 | downstream_gene_variant ; 1387.0bp to feature; MODIFIER | silent_mutation | Average:41.149; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0329183619 | C -> T | LOC_Os03g51040-LOC_Os03g51050 | intergenic_region ; MODIFIER | silent_mutation | Average:41.149; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0329183619 | NA | 7.25E-06 | mr1010 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 5.15E-06 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 8.24E-06 | mr1163 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 6.36E-07 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 5.13E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 4.52E-08 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 1.08E-07 | mr1931 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 5.25E-09 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 1.51E-08 | mr1958 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329183619 | NA | 1.12E-07 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |