\
| Variant ID: vg0328953433 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28953433 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 96. )
TTTCTCCCGACTCCCCTCATGCCACCGCCGCTCACTAGTGCGAGCGCGATCCGTGCCACCTCCGGTACTGCTGCCCCACCTCGCCAGCTGGTTGGAAGGC[A/G]
TCAATGGTGCTAGTGACCTCCCCCTCCCACCCCCCATCCCCCTTCGTCGGCTCTTCATTGAAGTTTGGGTTGTCACCTCCCCGCTAGAAAAAAAGAGGAG
CTCCTCTTTTTTTCTAGCGGGGAGGTGACAACCCAAACTTCAATGAAGAGCCGACGAAGGGGGATGGGGGGTGGGAGGGGGAGGTCACTAGCACCATTGA[T/C]
GCCTTCCAACCAGCTGGCGAGGTGGGGCAGCAGTACCGGAGGTGGCACGGATCGCGCTCGCACTAGTGAGCGGCGGTGGCATGAGGGGAGTCGGGAGAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 25.50% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 67.20% | 32.50% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.80% | 8.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 40.00% | 59.10% | 0.86% | 0.00% | NA |
| Indica III | 913 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.20% | 32.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 27.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328953433 | A -> G | LOC_Os03g50710.1 | upstream_gene_variant ; 909.0bp to feature; MODIFIER | silent_mutation | Average:74.677; most accessible tissue: Callus, score: 96.443 | N | N | N | N |
| vg0328953433 | A -> G | LOC_Os03g50720.1 | upstream_gene_variant ; 3963.0bp to feature; MODIFIER | silent_mutation | Average:74.677; most accessible tissue: Callus, score: 96.443 | N | N | N | N |
| vg0328953433 | A -> G | LOC_Os03g50690-LOC_Os03g50710 | intergenic_region ; MODIFIER | silent_mutation | Average:74.677; most accessible tissue: Callus, score: 96.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328953433 | NA | 2.91E-07 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0328953433 | 8.92E-07 | NA | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | 9.35E-07 | 1.54E-08 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 3.04E-06 | mr1010 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | 1.03E-06 | NA | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | 3.12E-07 | 6.43E-09 | mr1051 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 5.72E-06 | mr1163 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 4.94E-09 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | 6.41E-06 | 2.86E-07 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 7.12E-06 | mr1657 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 4.96E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | 8.36E-06 | 8.35E-06 | mr1832 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 7.96E-07 | mr1931 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 2.07E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 9.10E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328953433 | NA | 1.83E-06 | mr1952_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |