Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328939602:

Variant ID: vg0328939602 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 28939602
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTAACATACTCAAGGCAGCAGAAGAACAAGTTAAGCTGATACGAGAACGTTTAAAGACAGCTCAGAACCGTCAAAAGAATTACGCTGACAATCGGAGG[C/T,A]
GAGATCTTGAGTTCGAAAAAGGAGACCATGTGTACCTGCGGGTATCACCTCTCCGTGGTATGAGGAAGTTTGGGATGTCCGGCAAGTTAGCGCCCCGCTA

Reverse complement sequence

TAGCGGGGCGCTAACTTGCCGGACATCCCAAACTTCCTCATACCACGGAGAGGTGATACCCGCAGGTACACATGGTCTCCTTTTTCGAACTCAAGATCTC[G/A,T]
CCTCCGATTGTCAGCGTAATTCTTTTGACGGTTCTGAGCTGTCTTTAAACGTTCTCGTATCAGCTTAACTTGTTCTTCTGCTGCCTTGAGTATGTTAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.50%	17.10%	2.92%	0.38%	A: 0.02%
All Indica	2759	69.80%	28.40%	1.12%	0.65%	A: 0.04%
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	61.00%	1.10%	37.92%	0.00%	NA
Indica I	595	90.90%	9.10%	0.00%	0.00%	NA
Indica II	465	45.40%	49.70%	3.23%	1.72%	NA
Indica III	913	67.80%	31.50%	0.33%	0.33%	NA
Indica Intermediate	786	70.50%	26.80%	1.65%	0.89%	A: 0.13%
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	1.00%	2.08%	0.00%	NA
Intermediate	90	80.00%	16.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0328939602	C -> T	LOC_Os03g50670.1	stop_gained ; p.Arg1305*; HIGH	stop_gained	Average:24.335; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg0328939602	C -> A	LOC_Os03g50670.1	synonymous_variant ; p.Arg1305Arg; LOW	synonymous_codon	Average:24.335; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg0328939602	C -> DEL	LOC_Os03g50670.1	N	frameshift_variant	Average:24.335; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0328939602	NA	4.91E-07	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	8.59E-06	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	1.83E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	9.55E-06	4.62E-08	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	9.17E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	9.58E-06	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	1.89E-06	mr1241	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	6.69E-06	6.69E-06	mr1294	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	9.42E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	7.03E-06	7.03E-06	mr1302	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	3.10E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	2.08E-06	2.08E-06	mr1470	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	1.45E-06	1.45E-06	mr1488	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	1.40E-06	1.40E-06	mr1507	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	1.60E-07	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	5.36E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	5.94E-06	5.94E-06	mr1832	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	1.36E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	9.10E-06	mr1931	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	9.54E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	2.46E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328939602	NA	2.90E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251