Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328922349:

Variant ID: vg0328922349 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 28922349
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGACCTCGTGGTATTGCGCCTGCATCCCTCGTCGACAGTGTTCGTCCCCGCGTGGTTTTCCTCCTCTAGTGCACCGCGATCTTAATTTTATAAAATTT[A/G]
TGACACGACTACAAATAAACGAATTGTAATAATACTTATCTGAAATGATATATTTGCAATGGTATGGATTAAATTAACCCATCAAATTAAGGGAGCCTTA

Reverse complement sequence

TAAGGCTCCCTTAATTTGATGGGTTAATTTAATCCATACCATTGCAAATATATCATTTCAGATAAGTATTATTACAATTCGTTTATTTGTAGTCGTGTCA[T/C]
AAATTTTATAAAATTAAGATCGCGGTGCACTAGAGGAGGAAAACCACGCGGGGACGAACACTGTCGACGAGGGATGCAGGCGCAATACCACGAGGTCGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	25.40%	0.06%	0.34%	NA
All Indica	2759	66.90%	32.50%	0.07%	0.54%	NA
All Japonica	1512	99.50%	0.40%	0.07%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	90.40%	9.40%	0.00%	0.17%	NA
Indica II	465	39.60%	58.90%	0.00%	1.51%	NA
Indica III	913	65.20%	34.40%	0.22%	0.22%	NA
Indica Intermediate	786	67.30%	32.10%	0.00%	0.64%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0328922349	A -> DEL	N	N	silent_mutation	Average:53.465; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0328922349	A -> G	LOC_Os03g50644.1	downstream_gene_variant ; 4643.0bp to feature; MODIFIER	silent_mutation	Average:53.465; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0328922349	A -> G	LOC_Os03g50644-LOC_Os03g50660	intergenic_region ; MODIFIER	silent_mutation	Average:53.465; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0328922349	6.34E-06	NA	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	6.11E-06	2.90E-08	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	7.01E-06	mr1010	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	3.07E-06	NA	mr1051	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	1.34E-06	1.20E-08	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	5.80E-06	mr1163	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	1.45E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	4.52E-06	2.06E-07	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	6.62E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	3.43E-06	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	7.55E-06	7.55E-06	mr1832	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	1.92E-06	mr1931	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	1.64E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349	NA	1.48E-06	mr1952_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251