\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328920994:

Variant ID: vg0328920994 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28920994
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GTATCTCTGTCGACAAGTCTATTCCAAAGATGAAAGGTTATACAAATTAATAGCCCCTCCCCGTTTTATTTTAAGTGTAACCATAAGTTTCTGTGTCCAA[T/C]
TTTGATCGTCCGTTTTATTCGAAAGTTTTTTATATAATTAGTATTTTTATTGTTCTGAGATGATAAAATATGAATAATATTTTATACATAACTTATGTTT

Reverse complement sequence

AAACATAAGTTATGTATAAAATATTATTCATATTTTATCATCTCAGAACAATAAAAATACTAATTATATAAAAAACTTTCGAATAAAACGGACGATCAAA[A/G]
TTGGACACAGAAACTTATGGTTACACTTAAAATAAAACGGGGAGGGGCTATTAATTTGTATAACCTTTCATCTTTGGAATAGACTTGTCGACAGAGATAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 19.10% 0.36% 6.16% NA
All Indica  2759 67.10% 29.90% 0.43% 2.54% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 2.20% 18.20% 1.49% 78.07% NA
Indica I  595 90.40% 9.40% 0.17% 0.00% NA
Indica II  465 39.80% 54.00% 1.08% 5.16% NA
Indica III  913 65.50% 32.00% 0.11% 2.41% NA
Indica Intermediate  786 67.40% 28.90% 0.64% 3.05% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 1.00% 1.04% 7.29% NA
Intermediate  90 72.20% 23.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328920994 T -> C LOC_Os03g50644.1 downstream_gene_variant ; 3288.0bp to feature; MODIFIER silent_mutation Average:35.939; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg0328920994 T -> C LOC_Os03g50644-LOC_Os03g50660 intergenic_region ; MODIFIER silent_mutation Average:35.939; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg0328920994 T -> DEL N N silent_mutation Average:35.939; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328920994 3.63E-06 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 4.57E-06 4.06E-08 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 5.80E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 4.26E-06 mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 1.16E-06 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 3.61E-07 8.39E-09 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 5.99E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 3.46E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 4.17E-09 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 1.40E-06 1.02E-07 mr1536 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 3.75E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 2.07E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 2.29E-06 2.29E-06 mr1832 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 7.94E-07 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 5.55E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 6.76E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 2.31E-10 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328920994 NA 7.20E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251