\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328906605:

Variant ID: vg0328906605 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28906605
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTGCAGCATGTTTTTCCGCGTTCAACTTTGACCATCCGTCTTATTTAAAATTTTTTTGAAAAAATTTAAAAACATAAGTCACGAGTAAAGTACTATT[T/C]
ATGTTTTATCATCTCATAACAACAAAAATACTAATTATAAAAAAATTTTAAATAAGACGAACGATCAAAATTGGGCGCGGATACTTATGGTTGTACTTAT

Reverse complement sequence

ATAAGTACAACCATAAGTATCCGCGCCCAATTTTGATCGTTCGTCTTATTTAAAATTTTTTTATAATTAGTATTTTTGTTGTTATGAGATGATAAAACAT[A/G]
AATAGTACTTTACTCGTGACTTATGTTTTTAAATTTTTTCAAAAAAATTTTAAATAAGACGGATGGTCAAAGTTGAACGCGGAAAAACATGCTGCACTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 17.40% 0.99% 6.62% NA
All Indica  2759 67.90% 28.70% 0.69% 2.65% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 5.20% 1.10% 8.92% 84.76% NA
Indica I  595 91.60% 8.40% 0.00% 0.00% NA
Indica II  465 39.10% 52.70% 1.72% 6.45% NA
Indica III  913 67.50% 30.90% 0.22% 1.42% NA
Indica Intermediate  786 67.60% 27.50% 1.15% 3.82% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 1.00% 2.08% 6.25% NA
Intermediate  90 71.10% 20.00% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328906605 T -> C LOC_Os03g50620.1 3_prime_UTR_variant ; 177.0bp to feature; MODIFIER silent_mutation Average:52.371; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0328906605 T -> C LOC_Os03g50620.2 downstream_gene_variant ; 2439.0bp to feature; MODIFIER silent_mutation Average:52.371; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0328906605 T -> DEL N N silent_mutation Average:52.371; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328906605 8.61E-06 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 7.25E-06 4.42E-08 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 3.44E-06 2.15E-06 mr1006 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 7.25E-06 NA mr1007 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 NA 6.52E-06 mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 6.64E-06 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 9.70E-07 8.74E-09 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 2.77E-06 2.35E-06 mr1052 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 NA 3.95E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 NA 9.99E-09 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 5.02E-06 1.28E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 1.63E-06 1.63E-06 mr1832 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 NA 1.52E-07 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 NA 6.21E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906605 NA 7.20E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251