\
| Variant ID: vg0328906064 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28906064 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 105. )
GAAGAAGGGATAAAAAAATAAAAAAAATCCATGTCATTGTCCACGTGGCGTGACACGTAGGCAAGACCACAGTCAAACGCGGCTTTGGACCGGGATGATA[C/T]
AATAAACCAAGTTTAGGGACCTCGATGTGCACTTTGTAAGTTCGTGGACCTAAGTGAAACCTCCTGACAAGTTTAAGGATCGCTGGTGTATTTTACTCTT
AAGAGTAAAATACACCAGCGATCCTTAAACTTGTCAGGAGGTTTCACTTAGGTCCACGAACTTACAAAGTGCACATCGAGGTCCCTAAACTTGGTTTATT[G/A]
TATCATCCCGGTCCAAAGCCGCGTTTGACTGTGGTCTTGCCTACGTGTCACGCCACGTGGACAATGACATGGATTTTTTTTATTTTTTTATCCCTTCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 17.20% | 1.21% | 6.37% | NA |
| All Indica | 2759 | 68.00% | 28.60% | 1.01% | 2.46% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.40% | 0.70% | 9.67% | 82.16% | NA |
| Indica I | 595 | 91.60% | 8.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 41.10% | 51.60% | 1.94% | 5.38% | NA |
| Indica III | 913 | 66.50% | 31.10% | 0.55% | 1.86% | NA |
| Indica Intermediate | 786 | 67.70% | 27.40% | 1.65% | 3.31% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 74.40% | 17.80% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328906064 | C -> T | LOC_Os03g50620.2 | downstream_gene_variant ; 1898.0bp to feature; MODIFIER | silent_mutation | Average:53.055; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0328906064 | C -> T | LOC_Os03g50620.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.055; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0328906064 | C -> DEL | N | N | silent_mutation | Average:53.055; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328906064 | 8.44E-06 | 2.20E-06 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 3.21E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 2.71E-06 | mr1030 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 2.33E-06 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 2.85E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 6.97E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 7.04E-07 | mr1241 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 5.01E-06 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | 1.48E-06 | 1.48E-06 | mr1470 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | 6.64E-07 | 6.64E-07 | mr1488 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 3.65E-07 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | 9.52E-06 | 9.52E-06 | mr1591 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 3.36E-06 | mr1657 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 1.60E-07 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 4.52E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 7.90E-08 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 7.85E-07 | mr1931 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 6.78E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 1.45E-07 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328906064 | NA | 1.40E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |