\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328906064:

Variant ID: vg0328906064 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28906064
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAAGGGATAAAAAAATAAAAAAAATCCATGTCATTGTCCACGTGGCGTGACACGTAGGCAAGACCACAGTCAAACGCGGCTTTGGACCGGGATGATA[C/T]
AATAAACCAAGTTTAGGGACCTCGATGTGCACTTTGTAAGTTCGTGGACCTAAGTGAAACCTCCTGACAAGTTTAAGGATCGCTGGTGTATTTTACTCTT

Reverse complement sequence

AAGAGTAAAATACACCAGCGATCCTTAAACTTGTCAGGAGGTTTCACTTAGGTCCACGAACTTACAAAGTGCACATCGAGGTCCCTAAACTTGGTTTATT[G/A]
TATCATCCCGGTCCAAAGCCGCGTTTGACTGTGGTCTTGCCTACGTGTCACGCCACGTGGACAATGACATGGATTTTTTTTATTTTTTTATCCCTTCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 17.20% 1.21% 6.37% NA
All Indica  2759 68.00% 28.60% 1.01% 2.46% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 7.40% 0.70% 9.67% 82.16% NA
Indica I  595 91.60% 8.20% 0.17% 0.00% NA
Indica II  465 41.10% 51.60% 1.94% 5.38% NA
Indica III  913 66.50% 31.10% 0.55% 1.86% NA
Indica Intermediate  786 67.70% 27.40% 1.65% 3.31% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 1.00% 2.08% 6.25% NA
Intermediate  90 74.40% 17.80% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328906064 C -> T LOC_Os03g50620.2 downstream_gene_variant ; 1898.0bp to feature; MODIFIER silent_mutation Average:53.055; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0328906064 C -> T LOC_Os03g50620.1 intron_variant ; MODIFIER silent_mutation Average:53.055; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0328906064 C -> DEL N N silent_mutation Average:53.055; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328906064 8.44E-06 2.20E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 3.21E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 2.71E-06 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 2.33E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 2.85E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 6.97E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 7.04E-07 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 5.01E-06 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 1.48E-06 1.48E-06 mr1470 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 6.64E-07 6.64E-07 mr1488 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 3.65E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 9.52E-06 9.52E-06 mr1591 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 3.36E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 1.60E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 4.52E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 7.90E-08 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 7.85E-07 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 6.78E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 1.45E-07 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328906064 NA 1.40E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251