\
| Variant ID: vg0328876399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28876399 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 122. )
TTGTCTCAGTCAGAGGAACCGTTGACAATTGTATCACCAGCGCAGCATCCTTCAAGTTGTACAAACCAAGAGGACTTCAGACCGCTGTTTCATGACAAAT[A/G]
TGATGACAATAGTGGTGGACCGTCCATAGCAACTATTTCAGTAAATGGAGGGTTCAACAGAGTATGTACCTTAGGATTCAAGAGCCAGTGTGAGTTTATG
CATAAACTCACACTGGCTCTTGAATCCTAAGGTACATACTCTGTTGAACCCTCCATTTACTGAAATAGTTGCTATGGACGGTCCACCACTATTGTCATCA[T/C]
ATTTGTCATGAAACAGCGGTCTGAAGTCCTCTTGGTTTGTACAACTTGAAGGATGCTGCGCTGGTGATACAATTGTCAACGGTTCCTCTGACTGAGACAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 23.60% | 0.02% | 0.36% | NA |
| All Indica | 2759 | 69.80% | 29.60% | 0.00% | 0.62% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 41.10% | 57.00% | 0.00% | 1.94% | NA |
| Indica III | 913 | 68.70% | 31.10% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 69.10% | 30.20% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328876399 | A -> DEL | LOC_Os03g50570.1 | N | frameshift_variant | Average:62.732; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0328876399 | A -> G | LOC_Os03g50570.1 | missense_variant ; p.Tyr103Cys; MODERATE | nonsynonymous_codon ; Y103C | Average:62.732; most accessible tissue: Zhenshan97 panicle, score: 75.67 | benign |
0.507 |
TOLERATED | 0.19 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328876399 | NA | 2.57E-06 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 3.87E-07 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 5.98E-06 | mr1163 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 3.22E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 1.18E-12 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 2.37E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 4.11E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 7.06E-06 | mr1252 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 1.24E-17 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 3.83E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | 7.40E-06 | 7.39E-06 | mr1832 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 1.03E-07 | mr1931 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 1.28E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 9.96E-06 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 9.70E-12 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 1.66E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | NA | 3.62E-07 | mr1952_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328876399 | 6.05E-06 | 3.20E-08 | mr1952_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |