\
| Variant ID: vg0328706766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28706766 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGCATAAAGCCCCTCGCCGAGCCACTTCTTTGACAATACATCATGATGAATAGGGTTCGACTCATTCATGTCTCCACACCCAGGTTGTGCCGCAGCCGC[C/T]
CTTCTGCCCGCAGCCCTATTCTATAAATTTGGCTGGCTACGTTACTTATAATCGCAGAACGAGCAATGAATCCCCAACGACAAACGAACAAGGGGCGAGG
CCTCGCCCCTTGTTCGTTTGTCGTTGGGGATTCATTGCTCGTTCTGCGATTATAAGTAACGTAGCCAGCCAAATTTATAGAATAGGGCTGCGGGCAGAAG[G/A]
GCGGCTGCGGCACAACCTGGGTGTGGAGACATGAATGAGTCGAACCCTATTCATCATGATGTATTGTCAAAGAAGTGGCTCGGCGAGGGGCTTTATGCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.10% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 3.60% | 1.30% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.40% | 11.60% | 5.04% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 2.90% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328706766 | C -> T | LOC_Os03g50325.1 | upstream_gene_variant ; 1273.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0328706766 | C -> T | LOC_Os03g50330.1 | downstream_gene_variant ; 1819.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0328706766 | C -> T | LOC_Os03g50325-LOC_Os03g50330 | intergenic_region ; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328706766 | NA | 1.11E-11 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328706766 | NA | 2.78E-13 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328706766 | 1.29E-09 | 6.74E-22 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328706766 | NA | 1.30E-11 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328706766 | 3.44E-09 | 1.01E-21 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328706766 | NA | 9.80E-06 | mr1521_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |