\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328555824:

Variant ID: vg0328555824 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 28555824
Reference Allele: TAAlternative Allele: CA,T
Primary Allele: TASecondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGCGATTCATTAGCGCGCGATTAATTAGATATTAAATAATTTTTTTCAAAAATAGTTTAATTTGTTTTTAAGCAACTTTTGTATAAAAACTTTTTTTG[TA/CA,T]
AAAAATACACCGTTTAGTAGTTTAAAAAACGTACGCGCGGAAAACAAGAGATATATGTTGAGAAGAGAGGGTGCCGAACACAGCCTTAATGTGGTGATAA

Reverse complement sequence

TTATCACCACATTAAGGCTGTGTTCGGCACCCTCTCTTCTCAACATATATCTCTTGTTTTCCGCGCGTACGTTTTTTAAACTACTAAACGGTGTATTTTT[TA/TG,A]
CAAAAAAAGTTTTTATACAAAAGTTGCTTAAAAACAAATTAAACTATTTTTGAAAAAAATTATTTAATATCTAATTAATCGCGCGCTAATGAATCGCTCC

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 17.80% 0.17% 0.00% T: 0.04%
All Indica  2759 78.40% 21.40% 0.14% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.00% 0.00% T: 0.13%
Aus  269 20.40% 78.80% 0.74% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 43.40% 55.90% 0.65% 0.00% NA
Indica III  913 84.40% 15.60% 0.00% 0.00% NA
Indica Intermediate  786 76.10% 23.80% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.60% 0.00% 0.00% T: 0.40%
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328555824 TA -> T LOC_Os03g50040.1 upstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0328555824 TA -> T LOC_Os03g50050.1 upstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0328555824 TA -> T LOC_Os03g50040.2 upstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0328555824 TA -> T LOC_Os03g50040-LOC_Os03g50050 intergenic_region ; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0328555824 TA -> CA LOC_Os03g50040.1 upstream_gene_variant ; 402.0bp to feature; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0328555824 TA -> CA LOC_Os03g50050.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0328555824 TA -> CA LOC_Os03g50040.2 upstream_gene_variant ; 402.0bp to feature; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0328555824 TA -> CA LOC_Os03g50040-LOC_Os03g50050 intergenic_region ; MODIFIER silent_mutation Average:87.488; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0328555824 TA CA -0.03 -0.02 -0.02 -0.01 -0.02 -0.03
vg0328555824 TA T -0.01 -0.07 -0.1 -0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328555824 NA 7.58E-10 mr1192 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 2.34E-14 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 2.05E-09 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 1.45E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 9.48E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 1.83E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 7.12E-06 7.11E-06 mr1470 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 3.05E-21 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 7.01E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 4.79E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 4.91E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 7.84E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 1.43E-06 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 1.17E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 4.68E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 7.30E-08 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 2.55E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 5.23E-07 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 2.85E-17 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 1.70E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328555824 NA 8.32E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251