\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328375479:

Variant ID: vg0328375479 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28375479
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.04, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGAGATGAGGATGGGAGAGAAGAGAGGAAAAGAGAGAGAAGACTGATGTGGCAATGCTGACAGGTGGAGCCCACGTGGGTCCTATGCTGACTCAGCCG[C/T,A]
CACGTAGGATAAAACCAGGGTCAAAACCACCGGAGGATTTAAACGGTTTTGTTAGTTGAGAGACGTCTGGTATCTGGTTTTGCTGTTAGGGGATGATTTT

Reverse complement sequence

AAAATCATCCCCTAACAGCAAAACCAGATACCAGACGTCTCTCAACTAACAAAACCGTTTAAATCCTCCGGTGGTTTTGACCCTGGTTTTATCCTACGTG[G/A,T]
CGGCTGAGTCAGCATAGGACCCACGTGGGCTCCACCTGTCAGCATTGCCACATCAGTCTTCTCTCTCTTTTCCTCTCTTCTCTCCCATCCTCATCTCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 9.40% 0.17% 0.59% A: 0.06%
All Indica  2759 93.60% 6.10% 0.22% 0.04% NA
All Japonica  1512 98.10% 0.10% 0.13% 1.59% NA
Aus  269 5.90% 94.10% 0.00% 0.00% NA
Indica I  595 95.30% 4.50% 0.17% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 93.40% 6.20% 0.33% 0.00% NA
Indica Intermediate  786 93.00% 6.60% 0.25% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 0.00% 0.20% 4.56% NA
Japonica Intermediate  241 98.80% 0.40% 0.41% 0.41% NA
VI/Aromatic  96 82.30% 15.60% 0.00% 0.00% A: 2.08%
Intermediate  90 87.80% 7.80% 0.00% 3.33% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328375479 C -> T LOC_Os03g49820.1 downstream_gene_variant ; 319.0bp to feature; MODIFIER silent_mutation Average:99.001; most accessible tissue: Zhenshan97 panicle, score: 99.802 N N N N
vg0328375479 C -> T LOC_Os03g49820-LOC_Os03g49830 intergenic_region ; MODIFIER silent_mutation Average:99.001; most accessible tissue: Zhenshan97 panicle, score: 99.802 N N N N
vg0328375479 C -> A LOC_Os03g49820.1 downstream_gene_variant ; 319.0bp to feature; MODIFIER silent_mutation Average:99.001; most accessible tissue: Zhenshan97 panicle, score: 99.802 N N N N
vg0328375479 C -> A LOC_Os03g49820-LOC_Os03g49830 intergenic_region ; MODIFIER silent_mutation Average:99.001; most accessible tissue: Zhenshan97 panicle, score: 99.802 N N N N
vg0328375479 C -> DEL N N silent_mutation Average:99.001; most accessible tissue: Zhenshan97 panicle, score: 99.802 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0328375479 C A 0.01 0.01 0.01 0.03 0.02 0.01
vg0328375479 C T -0.01 -0.01 -0.02 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328375479 NA 1.26E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.44E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.76E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 7.84E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 2.07E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 9.74E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 3.60E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 9.59E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 9.76E-10 mr1320 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 7.41E-07 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 2.33E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.62E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 2.70E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 2.49E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.32E-11 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.01E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 2.47E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 6.92E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 4.68E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 7.51E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 7.51E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 4.84E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.64E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 7.72E-07 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 2.35E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 3.07E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 6.22E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 5.21E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 8.05E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 8.35E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 3.56E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.30E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 3.63E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 5.73E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 1.10E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328375479 NA 5.25E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251