\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328245501:

Variant ID: vg0328245501 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28245501
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.17, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGCGCGCGGCCGAGTCCCTCCGTTCGAAAAAAAAAAAAAAGACAAAACCTGGTTTCCGTATCTAATGTTTGACTGTCCGTCTTATTTGAAAAAATTAT[A/G]
AAAAAATTTAAAAAGACAAGTCACGTATAAAATATTAATTATATTTTATCATCTAACAATAATAAAAATACAAATTATAAAAAAATTTTATATAAGACGG

Reverse complement sequence

CCGTCTTATATAAAATTTTTTTATAATTTGTATTTTTATTATTGTTAGATGATAAAATATAATTAATATTTTATACGTGACTTGTCTTTTTAAATTTTTT[T/C]
ATAATTTTTTCAAATAAGACGGACAGTCAAACATTAGATACGGAAACCAGGTTTTGTCTTTTTTTTTTTTTTCGAACGGAGGGACTCGGCCGCGCGCGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 23.80% 15.98% 17.12% NA
All Indica  2759 5.40% 39.40% 26.57% 28.60% NA
All Japonica  1512 98.60% 0.50% 0.40% 0.53% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 1.30% 53.60% 31.43% 13.61% NA
Indica II  465 8.80% 20.40% 27.53% 43.23% NA
Indica III  913 3.90% 48.70% 18.29% 29.03% NA
Indica Intermediate  786 8.10% 29.10% 31.93% 30.79% NA
Temperate Japonica  767 99.30% 0.30% 0.13% 0.26% NA
Tropical Japonica  504 98.00% 0.60% 0.60% 0.79% NA
Japonica Intermediate  241 97.50% 0.80% 0.83% 0.83% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 52.20% 17.80% 17.78% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328245501 A -> DEL N N silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N
vg0328245501 A -> G LOC_Os03g49600.1 upstream_gene_variant ; 154.0bp to feature; MODIFIER silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N
vg0328245501 A -> G LOC_Os03g49600.2 upstream_gene_variant ; 154.0bp to feature; MODIFIER silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N
vg0328245501 A -> G LOC_Os03g49600.4 upstream_gene_variant ; 154.0bp to feature; MODIFIER silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N
vg0328245501 A -> G LOC_Os03g49600.5 upstream_gene_variant ; 154.0bp to feature; MODIFIER silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N
vg0328245501 A -> G LOC_Os03g49600.3 upstream_gene_variant ; 154.0bp to feature; MODIFIER silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N
vg0328245501 A -> G LOC_Os03g49610.1 downstream_gene_variant ; 3230.0bp to feature; MODIFIER silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N
vg0328245501 A -> G LOC_Os03g49600-LOC_Os03g49610 intergenic_region ; MODIFIER silent_mutation Average:98.509; most accessible tissue: Zhenshan97 flower, score: 99.314 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0328245501 A G -0.04 -0.03 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328245501 NA 8.43E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 9.63E-49 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 2.10E-52 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 7.43E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 1.50E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 2.87E-31 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 2.39E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 7.26E-31 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 6.66E-61 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 3.29E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 1.64E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 4.97E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 4.56E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 4.55E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 6.86E-07 7.85E-09 mr1805 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 1.50E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 4.03E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 3.22E-56 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 6.78E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 4.18E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 6.98E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 3.63E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 1.69E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 8.31E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 2.55E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 2.91E-69 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 4.08E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 5.29E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 2.70E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328245501 NA 4.39E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251