\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328193610:

Variant ID: vg0328193610 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28193610
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGACGATGCGACTGAGGAGGCGGACAAGGCGGCGACGGCGGGGGATACAGACGGTGACGGAGGGGGCGGACAAGGCGGCGAGGCCGGGGGAGGAATAG[C/T,A]
GAGGTGTCTGCATGCGACGGAGTCCGGACCTGATGCGATGCGAACCGAAGAAAACATCCCAAACCAAAATTACCCCTAAACGATATTAGGAGATTACTTA

Reverse complement sequence

TAAGTAATCTCCTAATATCGTTTAGGGGTAATTTTGGTTTGGGATGTTTTCTTCGGTTCGCATCGCATCAGGTCCGGACTCCGTCGCATGCAGACACCTC[G/A,T]
CTATTCCTCCCCCGGCCTCGCCGCCTTGTCCGCCCCCTCCGTCACCGTCTGTATCCCCCGCCGTCGCCGCCTTGTCCGCCTCCTCAGTCGCATCGTCCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 3.00% 1.97% 0.19% NA
All Indica  2759 91.50% 4.90% 3.30% 0.33% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.00% 1.00% 2.02% 0.00% NA
Indica II  465 79.10% 15.90% 4.95% 0.00% NA
Indica III  913 92.20% 3.20% 3.61% 0.99% NA
Indica Intermediate  786 93.90% 3.20% 2.93% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328193610 C -> T LOC_Os03g49520.1 upstream_gene_variant ; 3495.0bp to feature; MODIFIER N Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> T LOC_Os03g49520.2 upstream_gene_variant ; 3495.0bp to feature; MODIFIER N Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> T LOC_Os03g49524.1 downstream_gene_variant ; 175.0bp to feature; MODIFIER N Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> T LOC_Os03g49520-LOC_Os03g49524 intergenic_region ; MODIFIER N Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> A LOC_Os03g49520.1 upstream_gene_variant ; 3495.0bp to feature; MODIFIER silent_mutation Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> A LOC_Os03g49520.2 upstream_gene_variant ; 3495.0bp to feature; MODIFIER silent_mutation Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> A LOC_Os03g49524.1 downstream_gene_variant ; 175.0bp to feature; MODIFIER silent_mutation Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> A LOC_Os03g49520-LOC_Os03g49524 intergenic_region ; MODIFIER silent_mutation Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0328193610 C -> DEL N N silent_mutation Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328193610 NA 2.12E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610 NA 8.19E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610 NA 6.06E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610 NA 6.09E-07 mr1482 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610 NA 6.59E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328193610 NA 1.93E-07 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251