\
| Variant ID: vg0328193610 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28193610 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )
ACGGACGATGCGACTGAGGAGGCGGACAAGGCGGCGACGGCGGGGGATACAGACGGTGACGGAGGGGGCGGACAAGGCGGCGAGGCCGGGGGAGGAATAG[C/T,A]
GAGGTGTCTGCATGCGACGGAGTCCGGACCTGATGCGATGCGAACCGAAGAAAACATCCCAAACCAAAATTACCCCTAAACGATATTAGGAGATTACTTA
TAAGTAATCTCCTAATATCGTTTAGGGGTAATTTTGGTTTGGGATGTTTTCTTCGGTTCGCATCGCATCAGGTCCGGACTCCGTCGCATGCAGACACCTC[G/A,T]
CTATTCCTCCCCCGGCCTCGCCGCCTTGTCCGCCCCCTCCGTCACCGTCTGTATCCCCCGCCGTCGCCGCCTTGTCCGCCTCCTCAGTCGCATCGTCCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 3.00% | 1.97% | 0.19% | NA |
| All Indica | 2759 | 91.50% | 4.90% | 3.30% | 0.33% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 1.00% | 2.02% | 0.00% | NA |
| Indica II | 465 | 79.10% | 15.90% | 4.95% | 0.00% | NA |
| Indica III | 913 | 92.20% | 3.20% | 3.61% | 0.99% | NA |
| Indica Intermediate | 786 | 93.90% | 3.20% | 2.93% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328193610 | C -> T | LOC_Os03g49520.1 | upstream_gene_variant ; 3495.0bp to feature; MODIFIER | N | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> T | LOC_Os03g49520.2 | upstream_gene_variant ; 3495.0bp to feature; MODIFIER | N | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> T | LOC_Os03g49524.1 | downstream_gene_variant ; 175.0bp to feature; MODIFIER | N | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> T | LOC_Os03g49520-LOC_Os03g49524 | intergenic_region ; MODIFIER | N | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> A | LOC_Os03g49520.1 | upstream_gene_variant ; 3495.0bp to feature; MODIFIER | silent_mutation | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> A | LOC_Os03g49520.2 | upstream_gene_variant ; 3495.0bp to feature; MODIFIER | silent_mutation | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> A | LOC_Os03g49524.1 | downstream_gene_variant ; 175.0bp to feature; MODIFIER | silent_mutation | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> A | LOC_Os03g49520-LOC_Os03g49524 | intergenic_region ; MODIFIER | silent_mutation | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0328193610 | C -> DEL | N | N | silent_mutation | Average:69.329; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328193610 | NA | 2.12E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328193610 | NA | 8.19E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328193610 | NA | 6.06E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328193610 | NA | 6.09E-07 | mr1482 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328193610 | NA | 6.59E-06 | mr1806 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328193610 | NA | 1.93E-07 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |