\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328058285:

Variant ID: vg0328058285 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28058285
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTGTTAAATATATTTTTATATATACATATAGTTTTACACATTTCACAAAAGTTTTTAAATAAGACGAATGGTCAAACATGTTTAAAAAAGTCAACGA[C/T]
GTCAAATATTTAAGGAAGGAGGGAGTATAAATATAACTACCGAGGACCAAGATAGCGATAATTAAATAACATAATAACACTCAAATGCAACAAAAGCAAG

Reverse complement sequence

CTTGCTTTTGTTGCATTTGAGTGTTATTATGTTATTTAATTATCGCTATCTTGGTCCTCGGTAGTTATATTTATACTCCCTCCTTCCTTAAATATTTGAC[G/A]
TCGTTGACTTTTTTAAACATGTTTGACCATTCGTCTTATTTAAAAACTTTTGTGAAATGTGTAAAACTATATGTATATATAAAAATATATTTAACAATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 18.70% 1.71% 12.89% NA
All Indica  2759 54.20% 21.60% 2.86% 21.38% NA
All Japonica  1512 99.20% 0.30% 0.07% 0.40% NA
Aus  269 6.70% 93.30% 0.00% 0.00% NA
Indica I  595 93.90% 3.90% 1.01% 1.18% NA
Indica II  465 17.80% 23.40% 5.59% 53.12% NA
Indica III  913 51.00% 30.10% 2.30% 16.54% NA
Indica Intermediate  786 49.20% 23.90% 3.31% 23.54% NA
Temperate Japonica  767 99.50% 0.10% 0.13% 0.26% NA
Tropical Japonica  504 99.20% 0.20% 0.00% 0.60% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 78.10% 20.80% 0.00% 1.04% NA
Intermediate  90 72.20% 13.30% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328058285 C -> T LOC_Os03g49270.1 upstream_gene_variant ; 3083.0bp to feature; MODIFIER silent_mutation Average:64.969; most accessible tissue: Callus, score: 95.196 N N N N
vg0328058285 C -> T LOC_Os03g49260.1 downstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:64.969; most accessible tissue: Callus, score: 95.196 N N N N
vg0328058285 C -> T LOC_Os03g49280.1 downstream_gene_variant ; 140.0bp to feature; MODIFIER silent_mutation Average:64.969; most accessible tissue: Callus, score: 95.196 N N N N
vg0328058285 C -> T LOC_Os03g49290.1 downstream_gene_variant ; 3140.0bp to feature; MODIFIER silent_mutation Average:64.969; most accessible tissue: Callus, score: 95.196 N N N N
vg0328058285 C -> T LOC_Os03g49260.2 downstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:64.969; most accessible tissue: Callus, score: 95.196 N N N N
vg0328058285 C -> T LOC_Os03g49270-LOC_Os03g49280 intergenic_region ; MODIFIER silent_mutation Average:64.969; most accessible tissue: Callus, score: 95.196 N N N N
vg0328058285 C -> DEL N N silent_mutation Average:64.969; most accessible tissue: Callus, score: 95.196 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328058285 NA 6.67E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 6.78E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 3.86E-06 NA mr1199 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 1.03E-06 mr1199 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 7.74E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 2.22E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 1.80E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 3.34E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 6.67E-14 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 1.80E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 1.08E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 3.66E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 1.46E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 1.01E-06 mr1640 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 6.17E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 3.11E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 7.91E-07 mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285 NA 1.49E-16 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251