Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328058285:

Variant ID: vg0328058285 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 28058285
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTGTTAAATATATTTTTATATATACATATAGTTTTACACATTTCACAAAAGTTTTTAAATAAGACGAATGGTCAAACATGTTTAAAAAAGTCAACGA[C/T]
GTCAAATATTTAAGGAAGGAGGGAGTATAAATATAACTACCGAGGACCAAGATAGCGATAATTAAATAACATAATAACACTCAAATGCAACAAAAGCAAG

Reverse complement sequence

CTTGCTTTTGTTGCATTTGAGTGTTATTATGTTATTTAATTATCGCTATCTTGGTCCTCGGTAGTTATATTTATACTCCCTCCTTCCTTAAATATTTGAC[G/A]
TCGTTGACTTTTTTAAACATGTTTGACCATTCGTCTTATTTAAAAACTTTTGTGAAATGTGTAAAACTATATGTATATATAAAAATATATTTAACAATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.70%	18.70%	1.71%	12.89%	NA
All Indica	2759	54.20%	21.60%	2.86%	21.38%	NA
All Japonica	1512	99.20%	0.30%	0.07%	0.40%	NA
Aus	269	6.70%	93.30%	0.00%	0.00%	NA
Indica I	595	93.90%	3.90%	1.01%	1.18%	NA
Indica II	465	17.80%	23.40%	5.59%	53.12%	NA
Indica III	913	51.00%	30.10%	2.30%	16.54%	NA
Indica Intermediate	786	49.20%	23.90%	3.31%	23.54%	NA
Temperate Japonica	767	99.50%	0.10%	0.13%	0.26%	NA
Tropical Japonica	504	99.20%	0.20%	0.00%	0.60%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	78.10%	20.80%	0.00%	1.04%	NA
Intermediate	90	72.20%	13.30%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0328058285	C -> T	LOC_Os03g49270.1	upstream_gene_variant ; 3083.0bp to feature; MODIFIER	silent_mutation	Average:64.969; most accessible tissue: Callus, score: 95.196	N	N	N	N
vg0328058285	C -> T	LOC_Os03g49260.1	downstream_gene_variant ; 4560.0bp to feature; MODIFIER	silent_mutation	Average:64.969; most accessible tissue: Callus, score: 95.196	N	N	N	N
vg0328058285	C -> T	LOC_Os03g49280.1	downstream_gene_variant ; 140.0bp to feature; MODIFIER	silent_mutation	Average:64.969; most accessible tissue: Callus, score: 95.196	N	N	N	N
vg0328058285	C -> T	LOC_Os03g49290.1	downstream_gene_variant ; 3140.0bp to feature; MODIFIER	silent_mutation	Average:64.969; most accessible tissue: Callus, score: 95.196	N	N	N	N
vg0328058285	C -> T	LOC_Os03g49260.2	downstream_gene_variant ; 4560.0bp to feature; MODIFIER	silent_mutation	Average:64.969; most accessible tissue: Callus, score: 95.196	N	N	N	N
vg0328058285	C -> T	LOC_Os03g49270-LOC_Os03g49280	intergenic_region ; MODIFIER	silent_mutation	Average:64.969; most accessible tissue: Callus, score: 95.196	N	N	N	N
vg0328058285	C -> DEL	N	N	silent_mutation	Average:64.969; most accessible tissue: Callus, score: 95.196	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0328058285	NA	6.67E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	6.78E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	3.86E-06	NA	mr1199	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	1.03E-06	mr1199	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	7.74E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	2.22E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	1.80E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	3.34E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	6.67E-14	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	1.80E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	1.08E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	3.66E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	1.46E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	1.01E-06	mr1640	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	6.17E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	3.11E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	7.91E-07	mr1199_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328058285	NA	1.49E-16	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251