\
| Variant ID: vg0328057363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28057363 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 124. )
AACCTTTAGTTTATTATTCGTGGTGAAAAAAATTGAAGGGGGTGCTCTGGGGGTATCCATCGATCTTGTGGTTGTAGGGGGGACTCAAGTCCCCCTGCAC[C/A]
CACGTTGGATCCGCCCCTGGATCCGACCGTTCCCGATCCAATTTCACCTTAGAAAGTGTCGCTGGATCTGCCTTGCTCGTGTTCGGATCTGTTCGTGCAA
TTGCACGAACAGATCCGAACACGAGCAAGGCAGATCCAGCGACACTTTCTAAGGTGAAATTGGATCGGGAACGGTCGGATCCAGGGGCGGATCCAACGTG[G/T]
GTGCAGGGGGACTTGAGTCCCCCCTACAACCACAAGATCGATGGATACCCCCAGAGCACCCCCTTCAATTTTTTTCACCACGAATAATAAACTAAAGGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 21.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 72.90% | 27.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.10% | 5.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 66.00% | 34.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.30% | 34.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 69.60% | 30.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 19.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328057363 | C -> A | LOC_Os03g49270.1 | upstream_gene_variant ; 2161.0bp to feature; MODIFIER | silent_mutation | Average:61.896; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0328057363 | C -> A | LOC_Os03g49260.1 | downstream_gene_variant ; 3638.0bp to feature; MODIFIER | silent_mutation | Average:61.896; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0328057363 | C -> A | LOC_Os03g49280.1 | downstream_gene_variant ; 1062.0bp to feature; MODIFIER | silent_mutation | Average:61.896; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0328057363 | C -> A | LOC_Os03g49290.1 | downstream_gene_variant ; 4062.0bp to feature; MODIFIER | silent_mutation | Average:61.896; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0328057363 | C -> A | LOC_Os03g49260.2 | downstream_gene_variant ; 3638.0bp to feature; MODIFIER | silent_mutation | Average:61.896; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0328057363 | C -> A | LOC_Os03g49270-LOC_Os03g49280 | intergenic_region ; MODIFIER | silent_mutation | Average:61.896; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328057363 | NA | 2.44E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.18E-07 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 6.12E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 6.29E-07 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 9.21E-06 | mr1199 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 2.57E-06 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 6.56E-07 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.07E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.44E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 2.19E-06 | mr1284 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 5.34E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 7.72E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.75E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 4.47E-06 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 8.18E-08 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 5.41E-16 | mr1386 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 2.21E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 2.14E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 3.32E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 2.61E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 3.62E-09 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 3.84E-08 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 4.82E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.49E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 4.48E-07 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 6.41E-07 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 4.65E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | 6.62E-06 | 6.62E-06 | mr1605 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 3.30E-06 | mr1640 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 9.39E-12 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 2.69E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 6.93E-07 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 7.73E-08 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 8.19E-12 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.32E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.10E-14 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 7.60E-06 | mr1921 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.42E-09 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 5.58E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 1.01E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 2.57E-20 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328057363 | NA | 8.52E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |