Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327983003:

Variant ID: vg0327983003 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27983003
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACCACCAAGGAGATGTCAATACAAAGAATGGATAGACACCAGAAGGATTCTAACTCCACCTAGCCGTGTCGTGCAGCTTGAACTACCAGAGCAATACAGG[G/A]
TTACTAAAGCGCGTTTTGAGAGAGGAGAGGGATCCTCACGTAGCGGTTAGCTATTATCGGACAACTTGGCATATTGAAATTTCTACTGTCATGCTTCCTT

Reverse complement sequence

AAGGAAGCATGACAGTAGAAATTTCAATATGCCAAGTTGTCCGATAATAGCTAACCGCTACGTGAGGATCCCTCTCCTCTCTCAAAACGCGCTTTAGTAA[C/T]
CCTGTATTGCTCTGGTAGTTCAAGCTGCACGACACGGCTAGGTGGAGTTAGAATCCTTCTGGTGTCTATCCATTCTTTGTATTGACATCTCCTTGGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	0.80%	6.86%	3.68%	NA
All Indica	2759	81.60%	1.30%	10.87%	6.20%	NA
All Japonica	1512	99.60%	0.10%	0.33%	0.00%	NA
Aus	269	96.70%	0.00%	3.35%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	52.30%	2.20%	26.88%	18.71%	NA
Indica III	913	86.10%	1.30%	8.76%	3.83%	NA
Indica Intermediate	786	80.00%	1.80%	11.96%	6.23%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	86.70%	0.00%	10.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327983003	G -> A	LOC_Os03g49126.1	upstream_gene_variant ; 846.0bp to feature; MODIFIER	silent_mutation	Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0327983003	G -> A	LOC_Os03g49132.1	upstream_gene_variant ; 4434.0bp to feature; MODIFIER	silent_mutation	Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0327983003	G -> A	LOC_Os03g49120.1	downstream_gene_variant ; 1040.0bp to feature; MODIFIER	silent_mutation	Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0327983003	G -> A	LOC_Os03g49120-LOC_Os03g49126	intergenic_region ; MODIFIER	silent_mutation	Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0327983003	G -> DEL	N	N	silent_mutation	Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327983003	NA	1.88E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	1.49E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	3.93E-07	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	4.79E-06	9.55E-12	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	8.52E-12	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	1.26E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	7.51E-09	mr1241	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	1.91E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	3.47E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	2.35E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	2.45E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	7.13E-07	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	3.12E-06	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	5.54E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	2.80E-08	mr1679	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	3.19E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	1.80E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	4.90E-09	mr1720	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	2.55E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	8.68E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	1.24E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	1.64E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	2.39E-06	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003	NA	2.59E-06	mr1448_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251