\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327983003:

Variant ID: vg0327983003 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27983003
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACCAAGGAGATGTCAATACAAAGAATGGATAGACACCAGAAGGATTCTAACTCCACCTAGCCGTGTCGTGCAGCTTGAACTACCAGAGCAATACAGG[G/A]
TTACTAAAGCGCGTTTTGAGAGAGGAGAGGGATCCTCACGTAGCGGTTAGCTATTATCGGACAACTTGGCATATTGAAATTTCTACTGTCATGCTTCCTT

Reverse complement sequence

AAGGAAGCATGACAGTAGAAATTTCAATATGCCAAGTTGTCCGATAATAGCTAACCGCTACGTGAGGATCCCTCTCCTCTCTCAAAACGCGCTTTAGTAA[C/T]
CCTGTATTGCTCTGGTAGTTCAAGCTGCACGACACGGCTAGGTGGAGTTAGAATCCTTCTGGTGTCTATCCATTCTTTGTATTGACATCTCCTTGGTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 0.80% 6.86% 3.68% NA
All Indica  2759 81.60% 1.30% 10.87% 6.20% NA
All Japonica  1512 99.60% 0.10% 0.33% 0.00% NA
Aus  269 96.70% 0.00% 3.35% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 52.30% 2.20% 26.88% 18.71% NA
Indica III  913 86.10% 1.30% 8.76% 3.83% NA
Indica Intermediate  786 80.00% 1.80% 11.96% 6.23% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 86.70% 0.00% 10.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327983003 G -> A LOC_Os03g49126.1 upstream_gene_variant ; 846.0bp to feature; MODIFIER silent_mutation Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0327983003 G -> A LOC_Os03g49132.1 upstream_gene_variant ; 4434.0bp to feature; MODIFIER silent_mutation Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0327983003 G -> A LOC_Os03g49120.1 downstream_gene_variant ; 1040.0bp to feature; MODIFIER silent_mutation Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0327983003 G -> A LOC_Os03g49120-LOC_Os03g49126 intergenic_region ; MODIFIER silent_mutation Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0327983003 G -> DEL N N silent_mutation Average:17.775; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327983003 NA 1.88E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 1.49E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 3.93E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 4.79E-06 9.55E-12 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 8.52E-12 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 1.26E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 7.51E-09 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 1.91E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 3.47E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 2.35E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 2.45E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 7.13E-07 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 3.12E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 5.54E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 2.80E-08 mr1679 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 3.19E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 1.80E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 4.90E-09 mr1720 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 2.55E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 8.68E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 1.24E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 1.64E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 2.39E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327983003 NA 2.59E-06 mr1448_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251