\
| Variant ID: vg0327982584 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27982584 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )
CTATTCGGCAGACCCGCACTACAGCTTGCGCATACATCGAGTGGGTCGATACAGAAAATCCCGTTCTCGACCTAACCACTTGTTTACAAGAAGGTCGCTG[G/A]
TATTTCGCATCCGAAAGTACTGAGCAATACTTACGGAGAAAAGCGGCTTATGAACGACAATGTCGTGAACAACAGAGCGACTGGCGGGTGCTAACTACGG
CCGTAGTTAGCACCCGCCAGTCGCTCTGTTGTTCACGACATTGTCGTTCATAAGCCGCTTTTCTCCGTAAGTATTGCTCAGTACTTTCGGATGCGAAATA[C/T]
CAGCGACCTTCTTGTAAACAAGTGGTTAGGTCGAGAACGGGATTTTCTGTATCGACCCACTCGATGTATGCGCAAGCTGTAGTGCGGGTCTGCCGAATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 11.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 81.00% | 19.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 51.00% | 48.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327982584 | G -> A | LOC_Os03g49126.1 | upstream_gene_variant ; 1265.0bp to feature; MODIFIER | silent_mutation | Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg0327982584 | G -> A | LOC_Os03g49132.1 | upstream_gene_variant ; 4853.0bp to feature; MODIFIER | silent_mutation | Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg0327982584 | G -> A | LOC_Os03g49120.1 | downstream_gene_variant ; 621.0bp to feature; MODIFIER | silent_mutation | Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| vg0327982584 | G -> A | LOC_Os03g49120-LOC_Os03g49126 | intergenic_region ; MODIFIER | silent_mutation | Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327982584 | NA | 3.42E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 6.32E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 3.57E-11 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 3.48E-11 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 7.47E-09 | mr1241 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 1.18E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 5.28E-06 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 1.51E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 6.23E-07 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 2.41E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 6.42E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 3.33E-07 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 7.32E-07 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 2.57E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 3.40E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 7.19E-07 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 5.40E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 3.82E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 2.16E-07 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327982584 | NA | 2.38E-06 | mr1448_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |