\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327982584:

Variant ID: vg0327982584 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27982584
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTCGGCAGACCCGCACTACAGCTTGCGCATACATCGAGTGGGTCGATACAGAAAATCCCGTTCTCGACCTAACCACTTGTTTACAAGAAGGTCGCTG[G/A]
TATTTCGCATCCGAAAGTACTGAGCAATACTTACGGAGAAAAGCGGCTTATGAACGACAATGTCGTGAACAACAGAGCGACTGGCGGGTGCTAACTACGG

Reverse complement sequence

CCGTAGTTAGCACCCGCCAGTCGCTCTGTTGTTCACGACATTGTCGTTCATAAGCCGCTTTTCTCCGTAAGTATTGCTCAGTACTTTCGGATGCGAAATA[C/T]
CAGCGACCTTCTTGTAAACAAGTGGTTAGGTCGAGAACGGGATTTTCTGTATCGACCCACTCGATGTATGCGCAAGCTGTAGTGCGGGTCTGCCGAATAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 11.50% 0.04% 0.00% NA
All Indica  2759 81.00% 19.00% 0.04% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 51.00% 48.80% 0.22% 0.00% NA
Indica III  913 85.50% 14.50% 0.00% 0.00% NA
Indica Intermediate  786 79.40% 20.60% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327982584 G -> A LOC_Os03g49126.1 upstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg0327982584 G -> A LOC_Os03g49132.1 upstream_gene_variant ; 4853.0bp to feature; MODIFIER silent_mutation Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg0327982584 G -> A LOC_Os03g49120.1 downstream_gene_variant ; 621.0bp to feature; MODIFIER silent_mutation Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg0327982584 G -> A LOC_Os03g49120-LOC_Os03g49126 intergenic_region ; MODIFIER silent_mutation Average:16.976; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327982584 NA 3.42E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 6.32E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 3.57E-11 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 3.48E-11 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 7.47E-09 mr1241 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 1.18E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 5.28E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 1.51E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 6.23E-07 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 2.41E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 6.42E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 3.33E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 7.32E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 2.57E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 3.40E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 7.19E-07 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 5.40E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 3.82E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 2.16E-07 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327982584 NA 2.38E-06 mr1448_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251