Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327970149:

Variant ID: vg0327970149 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27970149
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

ACACCATTTGGCGAAGTGAGTACTGCCGCAACGCCCGCCCCCTTGTGCGACCACGAACCGTCGGAGTACATCACCCAGGGCTGTTCAATGGGCTCGGGTT[C/T]
AGGGGCGAATGCCGGTGTCCATTCGGCCACAAAGTCGGCTAGCACTTAGGACTTGACAGCAGTGCGGGCAACAAAATGTAAGTCGAAAGGGGATAGCTCT

Reverse complement sequence

AGAGCTATCCCCTTTCGACTTACATTTTGTTGCCCGCACTGCTGTCAAGTCCTAAGTGCTAGCCGACTTTGTGGCCGAATGGACACCGGCATTCGCCCCT[G/A]
AACCCGAGCCCATTGAACAGCCCTGGGTGATGTACTCCGACGGTTCGTGGTCGCACAAGGGGGCGGGCGTTGCGGCAGTACTCACTTCGCCAAATGGTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	11.50%	0.06%	0.00%	NA
All Indica	2759	81.00%	18.90%	0.11%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	50.80%	48.60%	0.65%	0.00%	NA
Indica III	913	85.50%	14.50%	0.00%	0.00%	NA
Indica Intermediate	786	79.40%	20.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327970149	C -> T	LOC_Os03g49100.1	missense_variant ; p.Glu437Lys; MODERATE	nonsynonymous_codon ; E437K	Average:46.442; most accessible tissue: Minghui63 young leaf, score: 75.006	benign	0.673	TOLERATED	0.19

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327970149	NA	3.47E-09	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	5.88E-09	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	4.84E-06	mr1241	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	2.82E-07	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	2.23E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	4.67E-06	mr1657	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	9.64E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	7.53E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	5.49E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	8.80E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	4.63E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	7.64E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	9.07E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	7.08E-06	7.82E-10	mr1448_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327970149	NA	1.27E-07	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251