\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327967882:

Variant ID: vg0327967882 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27967882
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.33, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCATTTGTACCATTGTGATGTATTCTTCGATACATTTTTATTTAAAATCCATAAAGGTGCGTCTTATTTCCTTTTCGCTATTTTTGCATTGTCACTTC[A/G]
CGTGCTTTTTGTTGGGTCGGAACGTGTCGGCCCCTTTGCATATATTAGCGAAATAGGTTTTGACTTTTCAGCTTTCGGCTTCCGTTTTCGATCCGTTTTG

Reverse complement sequence

CAAAACGGATCGAAAACGGAAGCCGAAAGCTGAAAAGTCAAAACCTATTTCGCTAATATATGCAAAGGGGCCGACACGTTCCGACCCAACAAAAAGCACG[T/C]
GAAGTGACAATGCAAAAATAGCGAAAAGGAAATAAGACGCACCTTTATGGATTTTAAATAAAAATGTATCGAAGAATACATCACAATGGTACAAATGAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 13.80% 5.04% 3.15% NA
All Indica  2759 67.30% 19.30% 8.37% 5.04% NA
All Japonica  1512 95.80% 3.20% 0.40% 0.60% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 93.60% 0.30% 5.04% 1.01% NA
Indica II  465 39.80% 49.50% 6.45% 4.30% NA
Indica III  913 63.30% 14.70% 12.49% 9.53% NA
Indica Intermediate  786 68.30% 21.10% 7.25% 3.31% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 0.60% 0.99% 1.59% NA
Japonica Intermediate  241 98.30% 0.80% 0.41% 0.41% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327967882 A -> DEL N N silent_mutation Average:27.252; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0327967882 A -> G LOC_Os03g49090.1 downstream_gene_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:27.252; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0327967882 A -> G LOC_Os03g49100.1 downstream_gene_variant ; 1155.0bp to feature; MODIFIER silent_mutation Average:27.252; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0327967882 A -> G LOC_Os03g49110.1 downstream_gene_variant ; 4834.0bp to feature; MODIFIER silent_mutation Average:27.252; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0327967882 A -> G LOC_Os03g49090-LOC_Os03g49100 intergenic_region ; MODIFIER silent_mutation Average:27.252; most accessible tissue: Minghui63 root, score: 38.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327967882 NA 2.52E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 8.18E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 5.91E-10 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 2.30E-10 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 3.87E-08 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 4.77E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 5.45E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 8.71E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 1.11E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 3.86E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 9.23E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 8.62E-07 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 NA 7.03E-07 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 1.05E-06 NA mr1448_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327967882 2.47E-06 2.39E-09 mr1448_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251