\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327966361:

Variant ID: vg0327966361 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27966361
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.36, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCCAACACCCTGAAAGAGGCGAAAGCCGAAAACAAGCGGCTCCAATCCAAGTTGGAGAAAGAAAGAGAGGCTAGGGCCGAGGTCGATCGCCTCAAGGC[T/C]
GATCTGGAGAAAGCGAGAGAAGCCATAGCTGAGGTTGATCGCCTCCAGGCCGAATTAAGGAAAGAAAAGGCCCATTCCGCCGTGCTGATGGATTATTATA

Reverse complement sequence

TATAATAATCCATCAGCACGGCGGAATGGGCCTTTTCTTTCCTTAATTCGGCCTGGAGGCGATCAACCTCAGCTATGGCTTCTCTCGCTTTCTCCAGATC[A/G]
GCCTTGAGGCGATCGACCTCGGCCCTAGCCTCTCTTTCTTTCTCCAACTTGGATTGGAGCCGCTTGTTTTCGGCTTTCGCCTCTTTCAGGGTGTTGGCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 12.50% 0.55% 0.53% NA
All Indica  2759 81.10% 17.30% 0.69% 0.91% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.00% NA
Aus  269 96.70% 1.90% 1.49% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 51.60% 45.40% 1.29% 1.72% NA
Indica III  913 85.70% 12.80% 0.88% 0.66% NA
Indica Intermediate  786 79.30% 18.80% 0.51% 1.40% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327966361 T -> C LOC_Os03g49090.1 synonymous_variant ; p.Ala461Ala; LOW synonymous_codon Average:43.072; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg0327966361 T -> DEL LOC_Os03g49090.1 N frameshift_variant Average:43.072; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327966361 NA 5.68E-07 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 4.39E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 9.21E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 1.45E-10 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 8.99E-13 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 1.60E-08 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 4.83E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 4.90E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 6.38E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 4.08E-06 3.82E-08 mr1537 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 1.12E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 2.15E-08 mr1679 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 2.93E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 7.93E-09 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 1.05E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 4.54E-06 4.54E-06 mr1890 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 2.60E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 2.80E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 2.34E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 6.05E-07 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 1.52E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 7.17E-08 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327966361 NA 7.38E-08 mr1448_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251