\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327951721:

Variant ID: vg0327951721 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27951721
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.21, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CTCATCATCAGCAACAGATTGCTCTTCGTCTTCATCGTCATATCTTTGGTGTCGATGAGCAGTGGCACCTGCACCTTCTTCACCTGCAGCCTCAAGTAAA[C/T]
CAATGCGTCACACAATATTTTCATGTCCAATATTCATATTCTGAATGTTTTCAGTTAATTGTTTATGGGATTGATTCATTTTCTCAATTTGATCCACTAC

Reverse complement sequence

GTAGTGGATCAAATTGAGAAAATGAATCAATCCCATAAACAATTAACTGAAAACATTCAGAATATGAATATTGGACATGAAAATATTGTGTGACGCATTG[G/A]
TTTACTTGAGGCTGCAGGTGAAGAAGGTGCAGGTGCCACTGCTCATCGACACCAAAGATATGACGATGAAGACGAAGAGCAATCTGTTGCTGATGATGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 48.70% 0.59% 0.02% NA
All Indica  2759 29.30% 70.00% 0.69% 0.04% NA
All Japonica  1512 98.10% 1.70% 0.26% 0.00% NA
Aus  269 6.70% 92.20% 1.12% 0.00% NA
Indica I  595 7.10% 91.30% 1.68% 0.00% NA
Indica II  465 53.50% 45.40% 1.08% 0.00% NA
Indica III  913 28.10% 71.60% 0.11% 0.11% NA
Indica Intermediate  786 33.20% 66.40% 0.38% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.00% 0.79% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 68.80% 1.04% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327951721 C -> T LOC_Os03g49070.1 upstream_gene_variant ; 4019.0bp to feature; MODIFIER silent_mutation Average:12.31; most accessible tissue: Callus, score: 24.501 N N N N
vg0327951721 C -> T LOC_Os03g49050.1 downstream_gene_variant ; 2773.0bp to feature; MODIFIER silent_mutation Average:12.31; most accessible tissue: Callus, score: 24.501 N N N N
vg0327951721 C -> T LOC_Os03g49050-LOC_Os03g49070 intergenic_region ; MODIFIER silent_mutation Average:12.31; most accessible tissue: Callus, score: 24.501 N N N N
vg0327951721 C -> DEL N N silent_mutation Average:12.31; most accessible tissue: Callus, score: 24.501 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327951721 NA 6.31E-08 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 8.93E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.80E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 8.85E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 2.95E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.55E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.18E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 3.45E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.15E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.97E-09 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 3.90E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 2.09E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 6.10E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 2.29E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.66E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 9.10E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 3.26E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 4.37E-06 NA mr1647 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.41E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 2.02E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 2.47E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 2.28E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 3.25E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 3.25E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 7.39E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 4.44E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.37E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 3.07E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 3.55E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 5.53E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327951721 NA 1.44E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251