\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327935681:

Variant ID: vg0327935681 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27935681
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTTTATGTGCAATTACCAATTTGTTAAAAAGATCTTCGCAGGCGGACGGCACGCTTGCAAAGATAGTAAAAAAGATCTTCGCAGGCGGACCGCCC[G/C]
CCTGCGAAGATCTTTGGCCTATATAAGGGCAAGCCCGCGACGCCAAAATTTCTAAGTCAAGGCGGGAACCCTACAAATTTTGGTGCCGTCAGGCTGCCGA

Reverse complement sequence

TCGGCAGCCTGACGGCACCAAAATTTGTAGGGTTCCCGCCTTGACTTAGAAATTTTGGCGTCGCGGGCTTGCCCTTATATAGGCCAAAGATCTTCGCAGG[C/G]
GGGCGGTCCGCCTGCGAAGATCTTTTTTACTATCTTTGCAAGCGTGCCGTCCGCCTGCGAAGATCTTTTTAACAAATTGGTAATTGCACATAAAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 7.40% 8.48% 0.74% NA
All Indica  2759 76.80% 11.20% 11.74% 0.25% NA
All Japonica  1512 96.00% 0.40% 1.85% 1.72% NA
Aus  269 87.40% 7.10% 5.58% 0.00% NA
Indica I  595 71.80% 8.70% 18.99% 0.50% NA
Indica II  465 80.40% 9.90% 9.46% 0.22% NA
Indica III  913 79.70% 12.60% 7.56% 0.11% NA
Indica Intermediate  786 75.10% 12.20% 12.47% 0.25% NA
Temperate Japonica  767 95.70% 0.10% 1.30% 2.87% NA
Tropical Japonica  504 96.80% 0.60% 2.58% 0.00% NA
Japonica Intermediate  241 95.40% 0.80% 2.07% 1.66% NA
VI/Aromatic  96 62.50% 9.40% 28.12% 0.00% NA
Intermediate  90 81.10% 8.90% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327935681 G -> C LOC_Os03g49040.1 upstream_gene_variant ; 1333.0bp to feature; MODIFIER silent_mutation Average:40.484; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0327935681 G -> C LOC_Os03g49030.1 downstream_gene_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:40.484; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0327935681 G -> C LOC_Os03g49030-LOC_Os03g49040 intergenic_region ; MODIFIER silent_mutation Average:40.484; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0327935681 G -> DEL N N silent_mutation Average:40.484; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327935681 NA 7.41E-08 mr1193 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327935681 3.19E-07 3.19E-07 mr1459 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327935681 NA 2.03E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251