\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327932805:

Variant ID: vg0327932805 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27932805
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 350. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGAGTACGCTTCTTTAGATGAATGTCCAACATGCGGTGCAAGCCGGTACAAGTCGAATAGCAATACTGGCCTAGAACCCTCAGAAGCAACTGAGGGA[C/T]
GACAGAGAAAAATCCCGCAGCTTGTGATGTGGTACCTTCCTATCAAAGACCGCATTAAACGGATATACTCAAACCCGCGAGATGCGGAACTAATGCGCTG

Reverse complement sequence

CAGCGCATTAGTTCCGCATCTCGCGGGTTTGAGTATATCCGTTTAATGCGGTCTTTGATAGGAAGGTACCACATCACAAGCTGCGGGATTTTTCTCTGTC[G/A]
TCCCTCAGTTGCTTCTGAGGGTTCTAGGCCAGTATTGCTATTCGACTTGTACCGGCTTGCACCGCATGTTGGACATTCATCTAAAGAAGCGTACTCTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 7.90% 2.62% 0.19% NA
All Indica  2759 82.20% 13.00% 4.46% 0.33% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 53.30% 31.20% 14.62% 0.86% NA
Indica III  913 86.10% 11.90% 1.75% 0.22% NA
Indica Intermediate  786 81.70% 13.00% 4.96% 0.38% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327932805 C -> T LOC_Os03g49030.1 stop_gained ; p.Arg262*; HIGH stop_gained Average:37.808; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0327932805 C -> DEL LOC_Os03g49030.1 N frameshift_variant Average:37.808; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327932805 NA 8.00E-06 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 NA 9.63E-06 mr1005 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 NA 3.25E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 NA 3.69E-06 mr1011 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 7.59E-06 7.57E-06 mr1012 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 NA 3.85E-06 mr1012 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 NA 8.83E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 4.72E-06 1.35E-06 mr1831 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 4.41E-06 4.41E-06 mr1831 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327932805 NA 7.99E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251