Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327917023:

Variant ID: vg0327917023 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27917023
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

AAGCTAGGTTGGAGAAGCTTTTTTGGCTTATGTGAGGTAGATGTATGACTCAACCACTAAACTTAGACATTAAATCCACTGGCTTATAAATCATATAAGC[C/T]
AATAAGCTGACTTAAAAGTCTAGGCCAATAAACCTAAGCCTAAACAAAGAGGGCCTAAGTGACATTTTTATTGAAACCCCACGAATAGAATGGCATATCG

Reverse complement sequence

CGATATGCCATTCTATTCGTGGGGTTTCAATAAAAATGTCACTTAGGCCCTCTTTGTTTAGGCTTAGGTTTATTGGCCTAGACTTTTAAGTCAGCTTATT[G/A]
GCTTATATGATTTATAAGCCAGTGGATTTAATGTCTAAGTTTAGTGGTTGAGTCATACATCTACCTCACATAAGCCAAAAAAGCTTCTCCAACCTAGCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	29.60%	0.23%	0.28%	NA
All Indica	2759	49.50%	49.70%	0.36%	0.43%	NA
All Japonica	1512	99.00%	0.90%	0.00%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	55.50%	43.90%	0.17%	0.50%	NA
Indica II	465	61.70%	37.60%	0.00%	0.65%	NA
Indica III	913	43.70%	55.80%	0.44%	0.11%	NA
Indica Intermediate	786	44.70%	54.10%	0.64%	0.64%	NA
Temperate Japonica	767	99.50%	0.40%	0.00%	0.13%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327917023	C -> T	LOC_Os03g49010.1	upstream_gene_variant ; 1664.0bp to feature; MODIFIER	silent_mutation	Average:44.96; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0327917023	C -> T	LOC_Os03g49000.1	downstream_gene_variant ; 2018.0bp to feature; MODIFIER	silent_mutation	Average:44.96; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0327917023	C -> T	LOC_Os03g49000-LOC_Os03g49010	intergenic_region ; MODIFIER	silent_mutation	Average:44.96; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0327917023	C -> DEL	N	N	silent_mutation	Average:44.96; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327917023	NA	4.14E-08	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327917023	NA	8.59E-07	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327917023	NA	9.31E-08	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327917023	2.19E-06	2.19E-06	mr1854	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327917023	NA	5.28E-07	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251