\
| Variant ID: vg0327915031 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27915031 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGAAGAGTTCCAAGGCCAGCAAGGCAAGTCACACAGATCCCAAACAACCCTTTGAGCATGTTGATCCCGTTTAAAGCTATTGTTTCTATTCAACTATTG[C/T]
ATTTATTTTCGAATGTTATTGGGTGGAATTAACCTATTGTTTGTTATAGCCCTTTTTGTTATTGGTTCCTTTATTTCTTGATACCTTGGGTTATTTTAAC
GTTAAAATAACCCAAGGTATCAAGAAATAAAGGAACCAATAACAAAAAGGGCTATAACAAACAATAGGTTAATTCCACCCAATAACATTCGAAAATAAAT[G/A]
CAATAGTTGAATAGAAACAATAGCTTTAAACGGGATCAACATGCTCAAAGGGTTGTTTGGGATCTGTGTGACTTGCCTTGCTGGCCTTGGAACTCTTCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.30% | 4.20% | 20.74% | 33.71% | NA |
| All Indica | 2759 | 20.20% | 0.00% | 26.53% | 53.24% | NA |
| All Japonica | 1512 | 83.70% | 12.60% | 2.31% | 1.39% | NA |
| Aus | 269 | 9.70% | 0.00% | 68.03% | 22.30% | NA |
| Indica I | 595 | 27.20% | 0.00% | 10.76% | 62.02% | NA |
| Indica II | 465 | 6.70% | 0.00% | 32.26% | 61.08% | NA |
| Indica III | 913 | 23.80% | 0.00% | 33.41% | 42.83% | NA |
| Indica Intermediate | 786 | 18.70% | 0.10% | 27.10% | 54.07% | NA |
| Temperate Japonica | 767 | 76.70% | 19.80% | 3.00% | 0.52% | NA |
| Tropical Japonica | 504 | 95.40% | 1.40% | 0.79% | 2.38% | NA |
| Japonica Intermediate | 241 | 81.70% | 12.90% | 3.32% | 2.07% | NA |
| VI/Aromatic | 96 | 56.20% | 8.30% | 14.58% | 20.83% | NA |
| Intermediate | 90 | 55.60% | 1.10% | 17.78% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327915031 | C -> T | LOC_Os03g49010.1 | upstream_gene_variant ; 3656.0bp to feature; MODIFIER | silent_mutation | Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122 | N | N | N | N |
| vg0327915031 | C -> T | LOC_Os03g49000.1 | downstream_gene_variant ; 26.0bp to feature; MODIFIER | silent_mutation | Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122 | N | N | N | N |
| vg0327915031 | C -> T | LOC_Os03g49000-LOC_Os03g49010 | intergenic_region ; MODIFIER | silent_mutation | Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122 | N | N | N | N |
| vg0327915031 | C -> DEL | N | N | silent_mutation | Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327915031 | NA | 4.82E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0327915031 | NA | 1.64E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0327915031 | 1.33E-08 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 4.27E-10 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 3.08E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 5.68E-13 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 2.13E-07 | NA | mr1310_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 8.91E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | NA | 3.52E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | NA | 9.00E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 4.89E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 3.28E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327915031 | 3.85E-08 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |