Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327915031:

Variant ID: vg0327915031 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27915031
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGAAGAGTTCCAAGGCCAGCAAGGCAAGTCACACAGATCCCAAACAACCCTTTGAGCATGTTGATCCCGTTTAAAGCTATTGTTTCTATTCAACTATTG[C/T]
ATTTATTTTCGAATGTTATTGGGTGGAATTAACCTATTGTTTGTTATAGCCCTTTTTGTTATTGGTTCCTTTATTTCTTGATACCTTGGGTTATTTTAAC

Reverse complement sequence

GTTAAAATAACCCAAGGTATCAAGAAATAAAGGAACCAATAACAAAAAGGGCTATAACAAACAATAGGTTAATTCCACCCAATAACATTCGAAAATAAAT[G/A]
CAATAGTTGAATAGAAACAATAGCTTTAAACGGGATCAACATGCTCAAAGGGTTGTTTGGGATCTGTGTGACTTGCCTTGCTGGCCTTGGAACTCTTCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.30%	4.20%	20.74%	33.71%	NA
All Indica	2759	20.20%	0.00%	26.53%	53.24%	NA
All Japonica	1512	83.70%	12.60%	2.31%	1.39%	NA
Aus	269	9.70%	0.00%	68.03%	22.30%	NA
Indica I	595	27.20%	0.00%	10.76%	62.02%	NA
Indica II	465	6.70%	0.00%	32.26%	61.08%	NA
Indica III	913	23.80%	0.00%	33.41%	42.83%	NA
Indica Intermediate	786	18.70%	0.10%	27.10%	54.07%	NA
Temperate Japonica	767	76.70%	19.80%	3.00%	0.52%	NA
Tropical Japonica	504	95.40%	1.40%	0.79%	2.38%	NA
Japonica Intermediate	241	81.70%	12.90%	3.32%	2.07%	NA
VI/Aromatic	96	56.20%	8.30%	14.58%	20.83%	NA
Intermediate	90	55.60%	1.10%	17.78%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327915031	C -> T	LOC_Os03g49010.1	upstream_gene_variant ; 3656.0bp to feature; MODIFIER	silent_mutation	Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122	N	N	N	N
vg0327915031	C -> T	LOC_Os03g49000.1	downstream_gene_variant ; 26.0bp to feature; MODIFIER	silent_mutation	Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122	N	N	N	N
vg0327915031	C -> T	LOC_Os03g49000-LOC_Os03g49010	intergenic_region ; MODIFIER	silent_mutation	Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122	N	N	N	N
vg0327915031	C -> DEL	N	N	silent_mutation	Average:7.945; most accessible tissue: Minghui63 flag leaf, score: 11.122	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327915031	NA	4.82E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0327915031	NA	1.64E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0327915031	1.33E-08	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	4.27E-10	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	3.08E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	5.68E-13	NA	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	2.13E-07	NA	mr1310_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	8.91E-08	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	NA	3.52E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	NA	9.00E-10	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	4.89E-06	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	3.28E-06	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327915031	3.85E-08	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251