RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0327914592:

Variant ID: vg0327914592 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27914592
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGTGAGCCGCCGTAGACCCGATCGATCTCGGCCGTCCGTTTTGGATGGATCGATCTCGGCCGTCCGTTTTGGATGGATCGATCTCGGCCGTCCGTTC[C/G]
CGTGAACCGCTGCCGTGCGCCTGGTCCACCGCAAAACCCTAGCCGCTGACGCAATAAATCCCTTTTTCCTTTTCAAAAATAATTCGTTATTGTGTCATAA

Reverse complement sequence

TTATGACACAATAACGAATTATTTTTGAAAAGGAAAAAGGGATTTATTGCGTCAGCGGCTAGGGTTTTGCGGTGGACCAGGCGCACGGCAGCGGTTCACG[G/C]
GAACGGACGGCCGAGATCGATCCATCCAAAACGGACGGCCGAGATCGATCCATCCAAAACGGACGGCCGAGATCGATCGGGTCTACGGCGGCTCACGGCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.40%	0.20%	6.16%	10.24%	NA
All Indica	2759	77.80%	0.10%	9.97%	12.14%	NA
All Japonica	1512	99.30%	0.00%	0.07%	0.66%	NA
Aus	269	55.40%	1.50%	2.23%	40.89%	NA
Indica I	595	65.50%	0.00%	15.46%	18.99%	NA
Indica II	465	68.00%	0.00%	9.68%	22.37%	NA
Indica III	913	91.50%	0.10%	4.16%	4.27%	NA
Indica Intermediate	786	77.10%	0.10%	12.72%	10.05%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	76.00%	3.10%	6.25%	14.58%	NA
Intermediate	90	78.90%	1.10%	3.33%	16.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327914592	C -> DEL	N	N	silent_mutation	Average:15.386; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0327914592	C -> G	LOC_Os03g49010.1	upstream_gene_variant ; 4095.0bp to feature; MODIFIER	silent_mutation	Average:15.386; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0327914592	C -> G	LOC_Os03g49000.1	intron_variant ; MODIFIER	silent_mutation	Average:15.386; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327914592	7.31E-06	NA	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327914592	4.09E-07	NA	mr1022	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327914592	1.58E-08	NA	mr1055	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327914592	5.66E-06	NA	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327914592	5.46E-06	NA	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0327914592:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact