\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327889139:

Variant ID: vg0327889139 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27889139
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAATTAGTTAAATATAAAATTATTTGATTAGAAAAAAAATATGAAAGCGACTTAAAATACGATGAAACAGAGCGAGAGTATGTAGTGATAAGTGATGA[C/T]
CACTTAGGGCACCTTTGATTCACAGGATTAAGAAAACGTAGGAATAAGAAAAACATAGGATTTTGACATAAATGTAAGTGTAAAATAGAGAATTGTAAAA

Reverse complement sequence

TTTTACAATTCTCTATTTTACACTTACATTTATGTCAAAATCCTATGTTTTTCTTATTCCTACGTTTTCTTAATCCTGTGAATCAAAGGTGCCCTAAGTG[G/A]
TCATCACTTATCACTACATACTCTCGCTCTGTTTCATCGTATTTTAAGTCGCTTTCATATTTTTTTTCTAATCAAATAATTTTATATTTAACTAATTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 11.80% 13.50% 25.69% NA
All Indica  2759 18.20% 19.50% 19.25% 43.02% NA
All Japonica  1512 98.60% 0.50% 0.26% 0.66% NA
Aus  269 65.40% 0.40% 31.97% 2.23% NA
Indica I  595 10.30% 0.20% 20.34% 69.24% NA
Indica II  465 10.50% 50.10% 7.10% 32.26% NA
Indica III  913 25.50% 14.90% 27.82% 31.76% NA
Indica Intermediate  786 20.40% 21.40% 15.65% 42.62% NA
Temperate Japonica  767 99.20% 0.30% 0.13% 0.39% NA
Tropical Japonica  504 98.40% 0.80% 0.20% 0.60% NA
Japonica Intermediate  241 97.10% 0.40% 0.83% 1.66% NA
VI/Aromatic  96 90.60% 1.00% 8.33% 0.00% NA
Intermediate  90 63.30% 14.40% 10.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327889139 C -> T LOC_Os03g48970.1 upstream_gene_variant ; 1221.0bp to feature; MODIFIER silent_mutation Average:13.55; most accessible tissue: Callus, score: 25.346 N N N N
vg0327889139 C -> T LOC_Os03g48970.4 upstream_gene_variant ; 1221.0bp to feature; MODIFIER silent_mutation Average:13.55; most accessible tissue: Callus, score: 25.346 N N N N
vg0327889139 C -> T LOC_Os03g48970.2 upstream_gene_variant ; 1424.0bp to feature; MODIFIER silent_mutation Average:13.55; most accessible tissue: Callus, score: 25.346 N N N N
vg0327889139 C -> T LOC_Os03g48970.3 upstream_gene_variant ; 1424.0bp to feature; MODIFIER silent_mutation Average:13.55; most accessible tissue: Callus, score: 25.346 N N N N
vg0327889139 C -> T LOC_Os03g48960-LOC_Os03g48970 intergenic_region ; MODIFIER silent_mutation Average:13.55; most accessible tissue: Callus, score: 25.346 N N N N
vg0327889139 C -> DEL N N silent_mutation Average:13.55; most accessible tissue: Callus, score: 25.346 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327889139 NA 5.67E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 6.16E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 4.68E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 4.80E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 4.68E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 6.73E-11 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 9.72E-11 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 6.97E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 5.73E-07 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 3.52E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 4.35E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 3.17E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.34E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 4.81E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.07E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.24E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 5.91E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 4.13E-06 3.24E-08 mr1537 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.88E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.58E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 2.92E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 8.64E-06 8.64E-06 mr1663 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.58E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 4.25E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.36E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 9.67E-06 9.67E-06 mr1890 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 3.24E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 8.72E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.05E-07 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 5.53E-07 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 9.07E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 7.34E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.66E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 8.92E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 1.34E-07 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139 NA 9.40E-07 mr1448_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251