Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327889139:

Variant ID: vg0327889139 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27889139
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAATTAGTTAAATATAAAATTATTTGATTAGAAAAAAAATATGAAAGCGACTTAAAATACGATGAAACAGAGCGAGAGTATGTAGTGATAAGTGATGA[C/T]
CACTTAGGGCACCTTTGATTCACAGGATTAAGAAAACGTAGGAATAAGAAAAACATAGGATTTTGACATAAATGTAAGTGTAAAATAGAGAATTGTAAAA

Reverse complement sequence

TTTTACAATTCTCTATTTTACACTTACATTTATGTCAAAATCCTATGTTTTTCTTATTCCTACGTTTTCTTAATCCTGTGAATCAAAGGTGCCCTAAGTG[G/A]
TCATCACTTATCACTACATACTCTCGCTCTGTTTCATCGTATTTTAAGTCGCTTTCATATTTTTTTTCTAATCAAATAATTTTATATTTAACTAATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.00%	11.80%	13.50%	25.69%	NA
All Indica	2759	18.20%	19.50%	19.25%	43.02%	NA
All Japonica	1512	98.60%	0.50%	0.26%	0.66%	NA
Aus	269	65.40%	0.40%	31.97%	2.23%	NA
Indica I	595	10.30%	0.20%	20.34%	69.24%	NA
Indica II	465	10.50%	50.10%	7.10%	32.26%	NA
Indica III	913	25.50%	14.90%	27.82%	31.76%	NA
Indica Intermediate	786	20.40%	21.40%	15.65%	42.62%	NA
Temperate Japonica	767	99.20%	0.30%	0.13%	0.39%	NA
Tropical Japonica	504	98.40%	0.80%	0.20%	0.60%	NA
Japonica Intermediate	241	97.10%	0.40%	0.83%	1.66%	NA
VI/Aromatic	96	90.60%	1.00%	8.33%	0.00%	NA
Intermediate	90	63.30%	14.40%	10.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327889139	C -> T	LOC_Os03g48970.1	upstream_gene_variant ; 1221.0bp to feature; MODIFIER	silent_mutation	Average:13.55; most accessible tissue: Callus, score: 25.346	N	N	N	N
vg0327889139	C -> T	LOC_Os03g48970.4	upstream_gene_variant ; 1221.0bp to feature; MODIFIER	silent_mutation	Average:13.55; most accessible tissue: Callus, score: 25.346	N	N	N	N
vg0327889139	C -> T	LOC_Os03g48970.2	upstream_gene_variant ; 1424.0bp to feature; MODIFIER	silent_mutation	Average:13.55; most accessible tissue: Callus, score: 25.346	N	N	N	N
vg0327889139	C -> T	LOC_Os03g48970.3	upstream_gene_variant ; 1424.0bp to feature; MODIFIER	silent_mutation	Average:13.55; most accessible tissue: Callus, score: 25.346	N	N	N	N
vg0327889139	C -> T	LOC_Os03g48960-LOC_Os03g48970	intergenic_region ; MODIFIER	silent_mutation	Average:13.55; most accessible tissue: Callus, score: 25.346	N	N	N	N
vg0327889139	C -> DEL	N	N	silent_mutation	Average:13.55; most accessible tissue: Callus, score: 25.346	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327889139	NA	5.67E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	6.16E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	4.68E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	4.80E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	4.68E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	6.73E-11	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	9.72E-11	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	6.97E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	5.73E-07	mr1241	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	3.52E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	4.35E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	3.17E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.34E-06	mr1297	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	4.81E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.07E-06	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.24E-07	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	5.91E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	4.13E-06	3.24E-08	mr1537	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.88E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.58E-06	mr1657	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	2.92E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	8.64E-06	8.64E-06	mr1663	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.58E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	4.25E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.36E-07	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	9.67E-06	9.67E-06	mr1890	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	3.24E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	8.72E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.05E-07	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	5.53E-07	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	9.07E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	7.34E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.66E-06	mr1972	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	8.92E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	1.34E-07	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327889139	NA	9.40E-07	mr1448_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251