\
| Variant ID: vg0327847208 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27847208 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCATGTCGCCGAGGTGCTCGACGAATTGTCCCAACAGGGAAGGCGCAGCAGCGGTGGTGGCTGCTCCTCGGTGTTCTGGCTGGAAATGATGAGTAGGGCA[G/A]
TCCACGCCGCCGCGAGGGGCGGCAACGTGGAGATGCTGAGGGAGCTCATCGAGCGTCGCTCCGACGTGTCGGAGTATCTCGACTTCCGTGGATCCACCGT
ACGGTGGATCCACGGAAGTCGAGATACTCCGACACGTCGGAGCGACGCTCGATGAGCTCCCTCAGCATCTCCACGTTGCCGCCCCTCGCGGCGGCGTGGA[C/T]
TGCCCTACTCATCATTTCCAGCCAGAACACCGAGGAGCAGCCACCACCGCTGCTGCGCCTTCCCTGTTGGGACAATTCGTCGAGCACCTCGGCGACATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 2.60% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 94.60% | 4.20% | 1.12% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 78.70% | 17.40% | 3.87% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 2.00% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327847208 | G -> A | LOC_Os03g48904.1 | missense_variant ; p.Val52Ile; MODERATE | nonsynonymous_codon ; V52I | Average:50.751; most accessible tissue: Zhenshan97 panicle, score: 65.386 | benign |
0.877 |
DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327847208 | NA | 1.37E-08 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 1.43E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 9.87E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 8.37E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 7.83E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 2.46E-08 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 2.04E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 8.15E-07 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | 8.22E-06 | 8.22E-06 | mr1342 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 5.19E-08 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 8.51E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327847208 | NA | 2.23E-09 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |