\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327847208:

Variant ID: vg0327847208 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27847208
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATGTCGCCGAGGTGCTCGACGAATTGTCCCAACAGGGAAGGCGCAGCAGCGGTGGTGGCTGCTCCTCGGTGTTCTGGCTGGAAATGATGAGTAGGGCA[G/A]
TCCACGCCGCCGCGAGGGGCGGCAACGTGGAGATGCTGAGGGAGCTCATCGAGCGTCGCTCCGACGTGTCGGAGTATCTCGACTTCCGTGGATCCACCGT

Reverse complement sequence

ACGGTGGATCCACGGAAGTCGAGATACTCCGACACGTCGGAGCGACGCTCGATGAGCTCCCTCAGCATCTCCACGTTGCCGCCCCTCGCGGCGGCGTGGA[C/T]
TGCCCTACTCATCATTTCCAGCCAGAACACCGAGGAGCAGCCACCACCGCTGCTGCGCCTTCCCTGTTGGGACAATTCGTCGAGCACCTCGGCGACATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 2.60% 0.70% 0.00% NA
All Indica  2759 94.60% 4.20% 1.12% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 78.70% 17.40% 3.87% 0.00% NA
Indica III  913 97.70% 2.20% 0.11% 0.00% NA
Indica Intermediate  786 96.70% 2.00% 1.27% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327847208 G -> A LOC_Os03g48904.1 missense_variant ; p.Val52Ile; MODERATE nonsynonymous_codon ; V52I Average:50.751; most accessible tissue: Zhenshan97 panicle, score: 65.386 benign 0.877 DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327847208 NA 1.37E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 1.43E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 9.87E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 8.37E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 7.83E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 2.46E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 2.04E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 8.15E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 8.22E-06 8.22E-06 mr1342 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 5.19E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 8.51E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327847208 NA 2.23E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251