\
| Variant ID: vg0327810589 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27810589 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 127. )
AAGGCGGTGAGGCCGGGGGAGGAATAGCGAGGTGACTGCGTGCAACGGAGTTCGGACCTGATACGATGCGAACAGAAGAAAACATCCCATGCCAAAATTA[C/T]
CCCTAAACGATATTAGGAGATTATTTACCTGCCCTTTAAAATAAACGGTCAAGATTAATTCTACTTAGAGTAGAATACTGCAAGTAGATTGCACCGGAGC
GCTCCGGTGCAATCTACTTGCAGTATTCTACTCTAAGTAGAATTAATCTTGACCGTTTATTTTAAAGGGCAGGTAAATAATCTCCTAATATCGTTTAGGG[G/A]
TAATTTTGGCATGGGATGTTTTCTTCTGTTCGCATCGTATCAGGTCCGAACTCCGTTGCACGCAGTCACCTCGCTATTCCTCCCCCGGCCTCACCGCCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.70% | 7.20% | 0.83% | 0.21% | NA |
| All Indica | 2759 | 95.50% | 4.00% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.70% | 77.30% | 9.29% | 3.72% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 92.30% | 6.70% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327810589 | C -> T | LOC_Os03g48810.1 | upstream_gene_variant ; 1572.0bp to feature; MODIFIER | silent_mutation | Average:42.949; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0327810589 | C -> T | LOC_Os03g48780-LOC_Os03g48810 | intergenic_region ; MODIFIER | silent_mutation | Average:42.949; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0327810589 | C -> DEL | N | N | silent_mutation | Average:42.949; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327810589 | NA | 5.40E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 5.82E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 1.61E-07 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 5.13E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 2.04E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 6.34E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 5.61E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 2.90E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 4.46E-06 | mr1467 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 6.34E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 2.40E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 1.45E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 5.10E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 4.18E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 3.30E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | 1.68E-07 | 2.35E-07 | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810589 | NA | 6.79E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |