\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327810553:

Variant ID: vg0327810553 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27810553
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGGGAATACGGATGGCGACGGAGGGGGCGGACAAGGCGGTGAGGCCGGGGGAGGAATAGCGAGGTGACTGCGTGCAACGGAGTTCGGACCTGATAC[G/A]
ATGCGAACAGAAGAAAACATCCCATGCCAAAATTACCCCTAAACGATATTAGGAGATTATTTACCTGCCCTTTAAAATAAACGGTCAAGATTAATTCTAC

Reverse complement sequence

GTAGAATTAATCTTGACCGTTTATTTTAAAGGGCAGGTAAATAATCTCCTAATATCGTTTAGGGGTAATTTTGGCATGGGATGTTTTCTTCTGTTCGCAT[C/T]
GTATCAGGTCCGAACTCCGTTGCACGCAGTCACCTCGCTATTCCTCCCCCGGCCTCACCGCCTTGTCCGCCCCCTCCGTCGCCATCCGTATTCCCCGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 25.00% 11.49% 5.10% NA
All Indica  2759 40.70% 32.60% 18.48% 8.26% NA
All Japonica  1512 97.80% 1.60% 0.26% 0.33% NA
Aus  269 5.20% 86.20% 6.69% 1.86% NA
Indica I  595 54.60% 16.00% 25.04% 4.37% NA
Indica II  465 54.20% 22.20% 14.41% 9.25% NA
Indica III  913 27.50% 47.40% 14.13% 10.95% NA
Indica Intermediate  786 37.40% 34.10% 20.99% 7.51% NA
Temperate Japonica  767 99.60% 0.30% 0.00% 0.13% NA
Tropical Japonica  504 95.20% 3.80% 0.60% 0.40% NA
Japonica Intermediate  241 97.50% 1.20% 0.41% 0.83% NA
VI/Aromatic  96 85.40% 12.50% 2.08% 0.00% NA
Intermediate  90 68.90% 17.80% 10.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327810553 G -> A LOC_Os03g48810.1 upstream_gene_variant ; 1608.0bp to feature; MODIFIER silent_mutation Average:45.316; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0327810553 G -> A LOC_Os03g48780-LOC_Os03g48810 intergenic_region ; MODIFIER silent_mutation Average:45.316; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0327810553 G -> DEL N N silent_mutation Average:45.316; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327810553 4.89E-06 1.47E-08 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 3.24E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 9.30E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 1.28E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 7.56E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 5.01E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 8.73E-06 mr1467 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 1.16E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 1.08E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 1.63E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 4.89E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 4.89E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 7.69E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 NA 2.47E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 2.10E-07 NA mr1193_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327810553 6.20E-07 5.44E-11 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251