\
| Variant ID: vg0327810553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27810553 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 195. )
CGGCGGGGAATACGGATGGCGACGGAGGGGGCGGACAAGGCGGTGAGGCCGGGGGAGGAATAGCGAGGTGACTGCGTGCAACGGAGTTCGGACCTGATAC[G/A]
ATGCGAACAGAAGAAAACATCCCATGCCAAAATTACCCCTAAACGATATTAGGAGATTATTTACCTGCCCTTTAAAATAAACGGTCAAGATTAATTCTAC
GTAGAATTAATCTTGACCGTTTATTTTAAAGGGCAGGTAAATAATCTCCTAATATCGTTTAGGGGTAATTTTGGCATGGGATGTTTTCTTCTGTTCGCAT[C/T]
GTATCAGGTCCGAACTCCGTTGCACGCAGTCACCTCGCTATTCCTCCCCCGGCCTCACCGCCTTGTCCGCCCCCTCCGTCGCCATCCGTATTCCCCGCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.40% | 25.00% | 11.49% | 5.10% | NA |
| All Indica | 2759 | 40.70% | 32.60% | 18.48% | 8.26% | NA |
| All Japonica | 1512 | 97.80% | 1.60% | 0.26% | 0.33% | NA |
| Aus | 269 | 5.20% | 86.20% | 6.69% | 1.86% | NA |
| Indica I | 595 | 54.60% | 16.00% | 25.04% | 4.37% | NA |
| Indica II | 465 | 54.20% | 22.20% | 14.41% | 9.25% | NA |
| Indica III | 913 | 27.50% | 47.40% | 14.13% | 10.95% | NA |
| Indica Intermediate | 786 | 37.40% | 34.10% | 20.99% | 7.51% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.20% | 3.80% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 85.40% | 12.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 17.80% | 10.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327810553 | G -> A | LOC_Os03g48810.1 | upstream_gene_variant ; 1608.0bp to feature; MODIFIER | silent_mutation | Average:45.316; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0327810553 | G -> A | LOC_Os03g48780-LOC_Os03g48810 | intergenic_region ; MODIFIER | silent_mutation | Average:45.316; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0327810553 | G -> DEL | N | N | silent_mutation | Average:45.316; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327810553 | 4.89E-06 | 1.47E-08 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 3.24E-06 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 9.30E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 1.28E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 7.56E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 5.01E-08 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 8.73E-06 | mr1467 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 1.16E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 1.08E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 1.63E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 4.89E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 4.89E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 7.69E-06 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | NA | 2.47E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | 2.10E-07 | NA | mr1193_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327810553 | 6.20E-07 | 5.44E-11 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |