Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327787353:

Variant ID: vg0327787353 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27787353
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.19, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAAATTTGGAATAAACATAATAAAATTAAAAGTAGAGTTTAGAGTCCGTATAAAAATATAATTTACAAATAACTAAAATTCAAAATTAAGAAAAACAT[G/T]
GGAAGAAGAGTTTAAAGTCAAAATAGGAATACAATTTAGAAGTAACTGAAATTCAAAATTAAAAATTAAATAATATTGAAAGATGAGTTTAGAGTCCACA

Reverse complement sequence

TGTGGACTCTAAACTCATCTTTCAATATTATTTAATTTTTAATTTTGAATTTCAGTTACTTCTAAATTGTATTCCTATTTTGACTTTAAACTCTTCTTCC[C/A]
ATGTTTTTCTTAATTTTGAATTTTAGTTATTTGTAAATTATATTTTTATACGGACTCTAAACTCTACTTTTAATTTTATTATGTTTATTCCAAATTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	7.60%	2.39%	0.04%	NA
All Indica	2759	84.60%	12.20%	3.15%	0.04%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	54.20%	35.10%	10.54%	0.22%	NA
Indica III	913	92.80%	6.20%	0.99%	0.00%	NA
Indica Intermediate	786	81.70%	14.60%	3.69%	0.00%	NA
Temperate Japonica	767	99.60%	0.10%	0.13%	0.13%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	69.80%	10.40%	19.79%	0.00%	NA
Intermediate	90	86.70%	7.80%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327787353	G -> T	LOC_Os03g48760.1	upstream_gene_variant ; 2772.0bp to feature; MODIFIER	silent_mutation	Average:13.787; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0327787353	G -> T	LOC_Os03g48770.1	downstream_gene_variant ; 698.0bp to feature; MODIFIER	silent_mutation	Average:13.787; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0327787353	G -> T	LOC_Os03g48780.1	downstream_gene_variant ; 3624.0bp to feature; MODIFIER	silent_mutation	Average:13.787; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0327787353	G -> T	LOC_Os03g48760-LOC_Os03g48770	intergenic_region ; MODIFIER	silent_mutation	Average:13.787; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0327787353	G -> DEL	N	N	silent_mutation	Average:13.787; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327787353	3.50E-06	3.49E-06	mr1012	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327787353	NA	8.53E-09	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327787353	NA	2.72E-08	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327787353	NA	6.92E-06	mr1448_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251