Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327762028:

Variant ID: vg0327762028 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27762028
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACATAGCCATAAGTAGGTTTTTTTAGGACGGCAGGAGGATGCAGCTCACAATTTTGCAAGCAATATACACATGTTATGCTTAACTCATTTATCAAAAA[G/A]
AAAATTGAAACATTTTAAGAAGCCAAATACAAAAGCAGTTATTTTAGGAAAAAACAAAATAAACACCTGACCAAACTGCTCAAAGATCTGTTATATTTAT

Reverse complement sequence

ATAAATATAACAGATCTTTGAGCAGTTTGGTCAGGTGTTTATTTTGTTTTTTCCTAAAATAACTGCTTTTGTATTTGGCTTCTTAAAATGTTTCAATTTT[C/T]
TTTTTGATAAATGAGTTAAGCATAACATGTGTATATTGCTTGCAAAATTGTGAGCTGCATCCTCCTGCCGTCCTAAAAAAACCTACTTATGGCTATGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	28.40%	2.16%	0.42%	NA
All Indica	2759	91.50%	7.60%	0.51%	0.43%	NA
All Japonica	1512	25.60%	68.80%	5.36%	0.26%	NA
Aus	269	95.90%	2.60%	1.12%	0.37%	NA
Indica I	595	95.50%	2.70%	1.01%	0.84%	NA
Indica II	465	97.00%	2.20%	0.43%	0.43%	NA
Indica III	913	87.70%	12.00%	0.11%	0.11%	NA
Indica Intermediate	786	89.60%	9.30%	0.64%	0.51%	NA
Temperate Japonica	767	44.10%	48.50%	7.17%	0.26%	NA
Tropical Japonica	504	6.90%	90.70%	2.18%	0.20%	NA
Japonica Intermediate	241	5.80%	87.60%	6.22%	0.41%	NA
VI/Aromatic	96	36.50%	61.50%	2.08%	0.00%	NA
Intermediate	90	65.60%	28.90%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327762028	G -> A	LOC_Os03g48710.4	downstream_gene_variant ; 978.0bp to feature; MODIFIER	silent_mutation	Average:72.762; most accessible tissue: Callus, score: 89.138	N	N	N	N
vg0327762028	G -> A	LOC_Os03g48710.2	downstream_gene_variant ; 884.0bp to feature; MODIFIER	silent_mutation	Average:72.762; most accessible tissue: Callus, score: 89.138	N	N	N	N
vg0327762028	G -> A	LOC_Os03g48710.3	downstream_gene_variant ; 915.0bp to feature; MODIFIER	silent_mutation	Average:72.762; most accessible tissue: Callus, score: 89.138	N	N	N	N
vg0327762028	G -> A	LOC_Os03g48710.1	downstream_gene_variant ; 978.0bp to feature; MODIFIER	silent_mutation	Average:72.762; most accessible tissue: Callus, score: 89.138	N	N	N	N
vg0327762028	G -> A	LOC_Os03g48690-LOC_Os03g48710	intergenic_region ; MODIFIER	silent_mutation	Average:72.762; most accessible tissue: Callus, score: 89.138	N	N	N	N
vg0327762028	G -> DEL	N	N	silent_mutation	Average:72.762; most accessible tissue: Callus, score: 89.138	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327762028	3.78E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028	NA	3.17E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028	2.05E-08	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028	NA	2.10E-08	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028	3.93E-10	2.34E-32	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028	NA	1.01E-10	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028	NA	2.92E-15	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028	NA	1.49E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251