\
| Variant ID: vg0327762028 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27762028 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAACATAGCCATAAGTAGGTTTTTTTAGGACGGCAGGAGGATGCAGCTCACAATTTTGCAAGCAATATACACATGTTATGCTTAACTCATTTATCAAAAA[G/A]
AAAATTGAAACATTTTAAGAAGCCAAATACAAAAGCAGTTATTTTAGGAAAAAACAAAATAAACACCTGACCAAACTGCTCAAAGATCTGTTATATTTAT
ATAAATATAACAGATCTTTGAGCAGTTTGGTCAGGTGTTTATTTTGTTTTTTCCTAAAATAACTGCTTTTGTATTTGGCTTCTTAAAATGTTTCAATTTT[C/T]
TTTTTGATAAATGAGTTAAGCATAACATGTGTATATTGCTTGCAAAATTGTGAGCTGCATCCTCCTGCCGTCCTAAAAAAACCTACTTATGGCTATGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.00% | 28.40% | 2.16% | 0.42% | NA |
| All Indica | 2759 | 91.50% | 7.60% | 0.51% | 0.43% | NA |
| All Japonica | 1512 | 25.60% | 68.80% | 5.36% | 0.26% | NA |
| Aus | 269 | 95.90% | 2.60% | 1.12% | 0.37% | NA |
| Indica I | 595 | 95.50% | 2.70% | 1.01% | 0.84% | NA |
| Indica II | 465 | 97.00% | 2.20% | 0.43% | 0.43% | NA |
| Indica III | 913 | 87.70% | 12.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 89.60% | 9.30% | 0.64% | 0.51% | NA |
| Temperate Japonica | 767 | 44.10% | 48.50% | 7.17% | 0.26% | NA |
| Tropical Japonica | 504 | 6.90% | 90.70% | 2.18% | 0.20% | NA |
| Japonica Intermediate | 241 | 5.80% | 87.60% | 6.22% | 0.41% | NA |
| VI/Aromatic | 96 | 36.50% | 61.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 28.90% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327762028 | G -> A | LOC_Os03g48710.4 | downstream_gene_variant ; 978.0bp to feature; MODIFIER | silent_mutation | Average:72.762; most accessible tissue: Callus, score: 89.138 | N | N | N | N |
| vg0327762028 | G -> A | LOC_Os03g48710.2 | downstream_gene_variant ; 884.0bp to feature; MODIFIER | silent_mutation | Average:72.762; most accessible tissue: Callus, score: 89.138 | N | N | N | N |
| vg0327762028 | G -> A | LOC_Os03g48710.3 | downstream_gene_variant ; 915.0bp to feature; MODIFIER | silent_mutation | Average:72.762; most accessible tissue: Callus, score: 89.138 | N | N | N | N |
| vg0327762028 | G -> A | LOC_Os03g48710.1 | downstream_gene_variant ; 978.0bp to feature; MODIFIER | silent_mutation | Average:72.762; most accessible tissue: Callus, score: 89.138 | N | N | N | N |
| vg0327762028 | G -> A | LOC_Os03g48690-LOC_Os03g48710 | intergenic_region ; MODIFIER | silent_mutation | Average:72.762; most accessible tissue: Callus, score: 89.138 | N | N | N | N |
| vg0327762028 | G -> DEL | N | N | silent_mutation | Average:72.762; most accessible tissue: Callus, score: 89.138 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327762028 | 3.78E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327762028 | NA | 3.17E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327762028 | 2.05E-08 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327762028 | NA | 2.10E-08 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327762028 | 3.93E-10 | 2.34E-32 | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327762028 | NA | 1.01E-10 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327762028 | NA | 2.92E-15 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327762028 | NA | 1.49E-07 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |