\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327762028:

Variant ID: vg0327762028 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27762028
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACATAGCCATAAGTAGGTTTTTTTAGGACGGCAGGAGGATGCAGCTCACAATTTTGCAAGCAATATACACATGTTATGCTTAACTCATTTATCAAAAA[G/A]
AAAATTGAAACATTTTAAGAAGCCAAATACAAAAGCAGTTATTTTAGGAAAAAACAAAATAAACACCTGACCAAACTGCTCAAAGATCTGTTATATTTAT

Reverse complement sequence

ATAAATATAACAGATCTTTGAGCAGTTTGGTCAGGTGTTTATTTTGTTTTTTCCTAAAATAACTGCTTTTGTATTTGGCTTCTTAAAATGTTTCAATTTT[C/T]
TTTTTGATAAATGAGTTAAGCATAACATGTGTATATTGCTTGCAAAATTGTGAGCTGCATCCTCCTGCCGTCCTAAAAAAACCTACTTATGGCTATGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 28.40% 2.16% 0.42% NA
All Indica  2759 91.50% 7.60% 0.51% 0.43% NA
All Japonica  1512 25.60% 68.80% 5.36% 0.26% NA
Aus  269 95.90% 2.60% 1.12% 0.37% NA
Indica I  595 95.50% 2.70% 1.01% 0.84% NA
Indica II  465 97.00% 2.20% 0.43% 0.43% NA
Indica III  913 87.70% 12.00% 0.11% 0.11% NA
Indica Intermediate  786 89.60% 9.30% 0.64% 0.51% NA
Temperate Japonica  767 44.10% 48.50% 7.17% 0.26% NA
Tropical Japonica  504 6.90% 90.70% 2.18% 0.20% NA
Japonica Intermediate  241 5.80% 87.60% 6.22% 0.41% NA
VI/Aromatic  96 36.50% 61.50% 2.08% 0.00% NA
Intermediate  90 65.60% 28.90% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327762028 G -> A LOC_Os03g48710.4 downstream_gene_variant ; 978.0bp to feature; MODIFIER silent_mutation Average:72.762; most accessible tissue: Callus, score: 89.138 N N N N
vg0327762028 G -> A LOC_Os03g48710.2 downstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:72.762; most accessible tissue: Callus, score: 89.138 N N N N
vg0327762028 G -> A LOC_Os03g48710.3 downstream_gene_variant ; 915.0bp to feature; MODIFIER silent_mutation Average:72.762; most accessible tissue: Callus, score: 89.138 N N N N
vg0327762028 G -> A LOC_Os03g48710.1 downstream_gene_variant ; 978.0bp to feature; MODIFIER silent_mutation Average:72.762; most accessible tissue: Callus, score: 89.138 N N N N
vg0327762028 G -> A LOC_Os03g48690-LOC_Os03g48710 intergenic_region ; MODIFIER silent_mutation Average:72.762; most accessible tissue: Callus, score: 89.138 N N N N
vg0327762028 G -> DEL N N silent_mutation Average:72.762; most accessible tissue: Callus, score: 89.138 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327762028 3.78E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028 NA 3.17E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028 2.05E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028 NA 2.10E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028 3.93E-10 2.34E-32 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028 NA 1.01E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028 NA 2.92E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327762028 NA 1.49E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251