\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327760034:

Variant ID: vg0327760034 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27760034
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCTAAATATTTGACGCCGTTAACTTTTTTAAACATGTTTGATCGTTCGTCTTATTCAAAAAATTTAACTTTTTTAAATATGTTTGACCGTTCGTCTTA[T/C]
TCAAAAAATTTAAGTAATTATTAATTTTTTTCCTATCATTTGATTTATTGTTAAATATACTACTACTACTCAAGTTTTTGAATAATATTCACAAAAGTTT

Reverse complement sequence

AAACTTTTGTGAATATTATTCAAAAACTTGAGTAGTAGTAGTATATTTAACAATAAATCAAATGATAGGAAAAAAATTAATAATTACTTAAATTTTTTGA[A/G]
TAAGACGAACGGTCAAACATATTTAAAAAAGTTAAATTTTTTGAATAAGACGAACGATCAAACATGTTTAAAAAAGTTAACGGCGTCAAATATTTAGGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 2.00% 1.42% 0.00% NA
All Indica  2759 94.30% 3.30% 2.39% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.10% 0.00% 2.86% 0.00% NA
Indica II  465 81.30% 14.00% 4.73% 0.00% NA
Indica III  913 97.90% 1.80% 0.33% 0.00% NA
Indica Intermediate  786 95.80% 1.10% 3.05% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327760034 T -> C LOC_Os03g48690.1 upstream_gene_variant ; 4688.0bp to feature; MODIFIER silent_mutation Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973 N N N N
vg0327760034 T -> C LOC_Os03g48710.4 downstream_gene_variant ; 2972.0bp to feature; MODIFIER silent_mutation Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973 N N N N
vg0327760034 T -> C LOC_Os03g48710.2 downstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973 N N N N
vg0327760034 T -> C LOC_Os03g48710.3 downstream_gene_variant ; 2909.0bp to feature; MODIFIER silent_mutation Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973 N N N N
vg0327760034 T -> C LOC_Os03g48710.1 downstream_gene_variant ; 2972.0bp to feature; MODIFIER silent_mutation Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973 N N N N
vg0327760034 T -> C LOC_Os03g48690-LOC_Os03g48710 intergenic_region ; MODIFIER silent_mutation Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327760034 NA 1.04E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 9.35E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 2.02E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 2.40E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 5.64E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 2.77E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 4.08E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 6.38E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 5.66E-06 mr1295 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 1.66E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 6.32E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 7.39E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 2.63E-06 NA mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 NA 8.10E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034 4.12E-06 NA mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251