Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327760034:

Variant ID: vg0327760034 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27760034
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCTAAATATTTGACGCCGTTAACTTTTTTAAACATGTTTGATCGTTCGTCTTATTCAAAAAATTTAACTTTTTTAAATATGTTTGACCGTTCGTCTTA[T/C]
TCAAAAAATTTAAGTAATTATTAATTTTTTTCCTATCATTTGATTTATTGTTAAATATACTACTACTACTCAAGTTTTTGAATAATATTCACAAAAGTTT

Reverse complement sequence

AAACTTTTGTGAATATTATTCAAAAACTTGAGTAGTAGTAGTATATTTAACAATAAATCAAATGATAGGAAAAAAATTAATAATTACTTAAATTTTTTGA[A/G]
TAAGACGAACGGTCAAACATATTTAAAAAAGTTAAATTTTTTGAATAAGACGAACGATCAAACATGTTTAAAAAAGTTAACGGCGTCAAATATTTAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	2.00%	1.42%	0.00%	NA
All Indica	2759	94.30%	3.30%	2.39%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.10%	0.00%	2.86%	0.00%	NA
Indica II	465	81.30%	14.00%	4.73%	0.00%	NA
Indica III	913	97.90%	1.80%	0.33%	0.00%	NA
Indica Intermediate	786	95.80%	1.10%	3.05%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327760034	T -> C	LOC_Os03g48690.1	upstream_gene_variant ; 4688.0bp to feature; MODIFIER	silent_mutation	Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973	N	N	N	N
vg0327760034	T -> C	LOC_Os03g48710.4	downstream_gene_variant ; 2972.0bp to feature; MODIFIER	silent_mutation	Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973	N	N	N	N
vg0327760034	T -> C	LOC_Os03g48710.2	downstream_gene_variant ; 2878.0bp to feature; MODIFIER	silent_mutation	Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973	N	N	N	N
vg0327760034	T -> C	LOC_Os03g48710.3	downstream_gene_variant ; 2909.0bp to feature; MODIFIER	silent_mutation	Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973	N	N	N	N
vg0327760034	T -> C	LOC_Os03g48710.1	downstream_gene_variant ; 2972.0bp to feature; MODIFIER	silent_mutation	Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973	N	N	N	N
vg0327760034	T -> C	LOC_Os03g48690-LOC_Os03g48710	intergenic_region ; MODIFIER	silent_mutation	Average:62.491; most accessible tissue: Minghui63 flower, score: 81.973	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327760034	NA	1.04E-07	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	9.35E-07	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	2.02E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	2.40E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	5.64E-08	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	2.77E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	4.08E-07	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	6.38E-07	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	5.66E-06	mr1295	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	1.66E-08	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	6.32E-06	mr1482	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	7.39E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	2.63E-06	NA	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	NA	8.10E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327760034	4.12E-06	NA	mr1219_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251