Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327701968:

Variant ID: vg0327701968 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27701968
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTGAGTTAGACCCTTTACCAGCCCGTTTTCGCCCAAGGAATAAGTTCACCCGCCATCCCTTAACTTTACGTCGAGTTTGTACGACATCCCTAATCCC[T/C]
AATACCAAAAATGTCGACCCCCTCAATTGTTCAAAACCATGCAAAATAAGTCCCTTAGTAGTATGGATAGGGGTTTCGCTGATGTGGCAAAGTTGACCTA

Reverse complement sequence

TAGGTCAACTTTGCCACATCAGCGAAACCCCTATCCATACTACTAAGGGACTTATTTTGCATGGTTTTGAACAATTGAGGGGGTCGACATTTTTGGTATT[A/G]
GGGATTAGGGATGTCGTACAAACTCGACGTAAAGTTAAGGGATGGCGGGTGAACTTATTCCTTGGGCGAAAACGGGCTGGTAAAGGGTCTAACTCAAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	38.80%	0.04%	0.32%	NA
All Indica	2759	90.20%	9.40%	0.04%	0.36%	NA
All Japonica	1512	2.70%	97.10%	0.00%	0.20%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	95.50%	4.20%	0.00%	0.34%	NA
Indica II	465	97.00%	2.60%	0.00%	0.43%	NA
Indica III	913	84.10%	15.60%	0.00%	0.33%	NA
Indica Intermediate	786	89.30%	10.20%	0.13%	0.38%	NA
Temperate Japonica	767	0.40%	99.30%	0.00%	0.26%	NA
Tropical Japonica	504	6.30%	93.50%	0.00%	0.20%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	54.40%	42.20%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327701968	T -> C	LOC_Os03g48590.1	downstream_gene_variant ; 1155.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.1	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.8	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.11	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.9	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.6	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.12	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.2	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.3	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.7	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48600.5	downstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> C	LOC_Os03g48580.1	intron_variant ; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0327701968	T -> DEL	N	N	silent_mutation	Average:64.978; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327701968	NA	2.62E-06	Awn_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0327701968	NA	1.75E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	NA	4.71E-59	mr1711	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	NA	3.76E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	3.46E-08	2.33E-134	mr1750	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	NA	2.14E-09	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	NA	1.02E-16	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	NA	1.16E-69	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	NA	3.43E-41	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	NA	1.35E-13	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327701968	4.44E-07	8.42E-168	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251