\
| Variant ID: vg0327686660 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27686660 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 117. )
TGATAATTTGTTCAATGAAAAAAGGTATTAATTAAAGTTACTTTCTTTTTTGTTATAAGTTACTTCTATAATATATGTAAATTACTTTTAAGATTGACTG[A/G]
ATTTACTTTTGTATGTCTAAGAAGTAACTTAGTGAAATCTAAAAGTAACTTAGACATATCATAAAAGTAATTTATGATTTTTCATCAAAATATAATCATG
CATGATTATATTTTGATGAAAAATCATAAATTACTTTTATGATATGTCTAAGTTACTTTTAGATTTCACTAAGTTACTTCTTAGACATACAAAAGTAAAT[T/C]
CAGTCAATCTTAAAAGTAATTTACATATATTATAGAAGTAACTTATAACAAAAAAGAAAGTAACTTTAATTAATACCTTTTTTCATTGAACAAATTATCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 40.90% | 1.95% | 1.18% | NA |
| All Indica | 2759 | 36.20% | 58.60% | 3.26% | 1.99% | NA |
| All Japonica | 1512 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 4.10% | 95.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 9.90% | 78.50% | 8.74% | 2.86% | NA |
| Indica II | 465 | 29.90% | 67.50% | 1.08% | 1.51% | NA |
| Indica III | 913 | 61.70% | 35.90% | 1.42% | 0.99% | NA |
| Indica Intermediate | 786 | 30.20% | 64.50% | 2.54% | 2.80% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 38.90% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327686660 | A -> DEL | N | N | silent_mutation | Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0327686660 | A -> G | LOC_Os03g48570.1 | upstream_gene_variant ; 4790.0bp to feature; MODIFIER | silent_mutation | Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0327686660 | A -> G | LOC_Os03g48560.1 | downstream_gene_variant ; 4906.0bp to feature; MODIFIER | silent_mutation | Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0327686660 | A -> G | LOC_Os03g48560-LOC_Os03g48570 | intergenic_region ; MODIFIER | silent_mutation | Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327686660 | NA | 2.39E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327686660 | 2.06E-06 | 1.08E-08 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327686660 | NA | 2.33E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327686660 | NA | 1.89E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327686660 | 4.56E-06 | NA | mr1984 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327686660 | NA | 6.64E-13 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327686660 | NA | 4.54E-06 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327686660 | NA | 6.80E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |