\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327686660:

Variant ID: vg0327686660 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27686660
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGATAATTTGTTCAATGAAAAAAGGTATTAATTAAAGTTACTTTCTTTTTTGTTATAAGTTACTTCTATAATATATGTAAATTACTTTTAAGATTGACTG[A/G]
ATTTACTTTTGTATGTCTAAGAAGTAACTTAGTGAAATCTAAAAGTAACTTAGACATATCATAAAAGTAATTTATGATTTTTCATCAAAATATAATCATG

Reverse complement sequence

CATGATTATATTTTGATGAAAAATCATAAATTACTTTTATGATATGTCTAAGTTACTTTTAGATTTCACTAAGTTACTTCTTAGACATACAAAAGTAAAT[T/C]
CAGTCAATCTTAAAAGTAATTTACATATATTATAGAAGTAACTTATAACAAAAAAGAAAGTAACTTTAATTAATACCTTTTTTCATTGAACAAATTATCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 40.90% 1.95% 1.18% NA
All Indica  2759 36.20% 58.60% 3.26% 1.99% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 4.10% 95.50% 0.37% 0.00% NA
Indica I  595 9.90% 78.50% 8.74% 2.86% NA
Indica II  465 29.90% 67.50% 1.08% 1.51% NA
Indica III  913 61.70% 35.90% 1.42% 0.99% NA
Indica Intermediate  786 30.20% 64.50% 2.54% 2.80% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327686660 A -> DEL N N silent_mutation Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0327686660 A -> G LOC_Os03g48570.1 upstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0327686660 A -> G LOC_Os03g48560.1 downstream_gene_variant ; 4906.0bp to feature; MODIFIER silent_mutation Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0327686660 A -> G LOC_Os03g48560-LOC_Os03g48570 intergenic_region ; MODIFIER silent_mutation Average:17.515; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327686660 NA 2.39E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327686660 2.06E-06 1.08E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327686660 NA 2.33E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327686660 NA 1.89E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327686660 4.56E-06 NA mr1984 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327686660 NA 6.64E-13 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327686660 NA 4.54E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327686660 NA 6.80E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251