\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327684087:

Variant ID: vg0327684087 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27684087
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACAGATGTTTTGTTTTTTTCTTAGAATTTGTAAAAATTTCTATTATTTATTAGAATGCCATGTGGCGACTTAGGAGCGTTTGTAGGATGTCATGTGG[C/T]
GATTTGAGAGTGTTTATAGGAAGTTTAATGTACTTTTAGTATATAATAGATAGATAGATAGATAGATAGATTGGTAATGGGATATATTTGTATTATTTTC

Reverse complement sequence

GAAAATAATACAAATATATCCCATTACCAATCTATCTATCTATCTATCTATCTATTATATACTAAAAGTACATTAAACTTCCTATAAACACTCTCAAATC[G/A]
CCACATGACATCCTACAAACGCTCCTAAGTCGCCACATGGCATTCTAATAAATAATAGAAATTTTTACAAATTCTAAGAAAAAAACAAAACATCTGTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 5.20% 1.02% 1.16% NA
All Indica  2759 88.50% 8.30% 1.74% 1.49% NA
All Japonica  1512 99.10% 0.00% 0.00% 0.86% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 55.10% 31.40% 7.73% 5.71% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.50% 0.40% 0.00% 0.11% NA
Indica Intermediate  786 94.80% 4.20% 0.25% 0.76% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 0.00% 0.00% 2.58% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327684087 C -> T LOC_Os03g48560.1 downstream_gene_variant ; 2333.0bp to feature; MODIFIER silent_mutation Average:54.042; most accessible tissue: Minghui63 root, score: 76.425 N N N N
vg0327684087 C -> T LOC_Os03g48560-LOC_Os03g48570 intergenic_region ; MODIFIER silent_mutation Average:54.042; most accessible tissue: Minghui63 root, score: 76.425 N N N N
vg0327684087 C -> DEL N N silent_mutation Average:54.042; most accessible tissue: Minghui63 root, score: 76.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327684087 NA 2.76E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327684087 NA 2.14E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327684087 NA 2.82E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327684087 2.77E-07 2.77E-07 mr1335_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327684087 8.13E-06 2.09E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251