\
| Variant ID: vg0327684087 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27684087 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 97. )
TGGACAGATGTTTTGTTTTTTTCTTAGAATTTGTAAAAATTTCTATTATTTATTAGAATGCCATGTGGCGACTTAGGAGCGTTTGTAGGATGTCATGTGG[C/T]
GATTTGAGAGTGTTTATAGGAAGTTTAATGTACTTTTAGTATATAATAGATAGATAGATAGATAGATAGATTGGTAATGGGATATATTTGTATTATTTTC
GAAAATAATACAAATATATCCCATTACCAATCTATCTATCTATCTATCTATCTATTATATACTAAAAGTACATTAAACTTCCTATAAACACTCTCAAATC[G/A]
CCACATGACATCCTACAAACGCTCCTAAGTCGCCACATGGCATTCTAATAAATAATAGAAATTTTTACAAATTCTAAGAAAAAAACAAAACATCTGTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 5.20% | 1.02% | 1.16% | NA |
| All Indica | 2759 | 88.50% | 8.30% | 1.74% | 1.49% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.00% | 0.86% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.10% | 31.40% | 7.73% | 5.71% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 94.80% | 4.20% | 0.25% | 0.76% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 0.00% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327684087 | C -> T | LOC_Os03g48560.1 | downstream_gene_variant ; 2333.0bp to feature; MODIFIER | silent_mutation | Average:54.042; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| vg0327684087 | C -> T | LOC_Os03g48560-LOC_Os03g48570 | intergenic_region ; MODIFIER | silent_mutation | Average:54.042; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| vg0327684087 | C -> DEL | N | N | silent_mutation | Average:54.042; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327684087 | NA | 2.76E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327684087 | NA | 2.14E-06 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327684087 | NA | 2.82E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327684087 | 2.77E-07 | 2.77E-07 | mr1335_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327684087 | 8.13E-06 | 2.09E-08 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |